Gene Page: GRM3
Summary ?
GeneID | 2913 |
Symbol | GRM3 |
Synonyms | GLUR3|GPRC1C|MGLUR3|mGlu3 |
Description | glutamate receptor, metabotropic 3 |
Reference | MIM:601115|HGNC:HGNC:4595|Ensembl:ENSG00000198822|HPRD:03070|Vega:OTTHUMG00000022884 |
Gene type | protein-coding |
Map location | 7q21.1-q21.2 |
Pascal p-value | 7.599E-5 |
Sherlock p-value | 0.941 |
Fetal beta | -0.539 |
eGene | Cerebellum |
Support | GPCR SIGNALLING G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanPSD G2Cdb.humanPSP Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
CV:PGC128 | Genome-wide Association Study | A multi-stage schizophrenia GWAS of up to 36,989 cases and 113,075 controls. Reported by the Schizophrenia Working Group of PGC. 128 independent associations spanning 108 loci | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Association | A combined odds ratio method (Sun et al. 2008), association studies | 2 | Link to SZGene |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 7 | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 31 |
Section I. Genetics and epigenetics annotation
CV:PGC128
SNP ID | Chromosome | Position | Allele | P | Function | Gene | Up/Down Distance |
---|---|---|---|---|---|---|---|
rs12704290 | chr7 | 86427626 | AG | 1.037E-10 | intronic | GRM3 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0001641 | group II metabotropic glutamate receptor activity | IEA | glutamate (GO term level: 8) | - |
GO:0004872 | receptor activity | IEA | - | |
GO:0005246 | calcium channel regulator activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007268 | synaptic transmission | TAS | neuron, Synap, Neurotransmitter (GO term level: 6) | 8840013 |
GO:0007186 | G-protein coupled receptor protein signaling pathway | IEA | - | |
GO:0007194 | negative regulation of adenylate cyclase activity | TAS | 8840013 | |
GO:0007165 | signal transduction | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0042734 | presynaptic membrane | IEA | neuron, axon, Synap (GO term level: 5) | - |
GO:0014069 | postsynaptic density | IEA | Synap (GO term level: 10) | - |
GO:0043197 | dendritic spine | IEA | Synap, dendrite (GO term level: 7) | - |
GO:0030424 | axon | IEA | neuron, axon, Neurotransmitter (GO term level: 6) | - |
GO:0045211 | postsynaptic membrane | IEA | Synap, Neurotransmitter (GO term level: 5) | - |
GO:0016021 | integral to membrane | IEA | - | |
GO:0005886 | plasma membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | TAS | 8840013 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION | 272 | 195 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
REACTOME CLASS C 3 METABOTROPIC GLUTAMATE PHEROMONE RECEPTORS | 15 | 11 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR LIGAND BINDING | 408 | 246 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
LEE TARGETS OF PTCH1 AND SUFU DN | 83 | 69 | All SZGR 2.0 genes in this pathway |
JOSEPH RESPONSE TO SODIUM BUTYRATE DN | 64 | 45 | All SZGR 2.0 genes in this pathway |
KONDO PROSTATE CANCER WITH H3K27ME3 | 196 | 93 | All SZGR 2.0 genes in this pathway |
RIZKI TUMOR INVASIVENESS 3D DN | 270 | 181 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF ICP WITH H3K27ME3 | 206 | 108 | All SZGR 2.0 genes in this pathway |
MIKKELSEN IPS ICP WITH H3K4ME3 AND H327ME3 | 126 | 83 | All SZGR 2.0 genes in this pathway |
MIKKELSEN ES ICP WITH H3K4ME3 AND H3K27ME3 | 137 | 85 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC ICP WITH H3K4ME3 | 445 | 257 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA NEURAL | 129 | 85 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-10 | 251 | 257 | m8 | hsa-miR-10a | UACCCUGUAGAUCCGAAUUUGUG |
hsa-miR-10b | UACCCUGUAGAACCGAAUUUGU | ||||
miR-30-5p | 227 | 234 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-339 | 250 | 256 | m8 | hsa-miR-339 | UCCCUGUCCUCCAGGAGCUCA |
miR-376 | 359 | 365 | 1A | hsa-miR-376a | AUCAUAGAGGAAAAUCCACGU |
hsa-miR-376b | AUCAUAGAGGAAAAUCCAUGUU | ||||
miR-381 | 413 | 419 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
miR-504 | 252 | 258 | m8 | hsa-miR-504 | AGACCCUGGUCUGCACUCUAU |
miR-539 | 450 | 456 | 1A | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.