Gene Page: AGRN
Summary ?
GeneID | 375790 |
Symbol | AGRN |
Synonyms | CMS8|CMSPPD |
Description | agrin |
Reference | MIM:103320|HGNC:HGNC:329|Ensembl:ENSG00000188157|HPRD:10550|Vega:OTTHUMG00000040778 |
Gene type | protein-coding |
Map location | 1p36.33 |
Pascal p-value | 0.488 |
Fetal beta | 0.811 |
DMG | 1 (# studies) |
eGene | Meta |
Support | CELL ADHESION AND TRANSSYNAPTIC SIGNALING CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 4 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg12469361 | 1 | 982189 | AGRN | 3.159E-4 | 0.292 | 0.04 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0016783 | sulfurtransferase activity | IEA | - | |
GO:0005200 | structural constituent of cytoskeleton | TAS | 9652404 | |
GO:0030548 | acetylcholine receptor regulator activity | IEA | - | |
GO:0043236 | laminin binding | TAS | 9652404 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0045162 | clustering of voltage-gated sodium channels | TAS | neuron, axon (GO term level: 12) | 9405491 |
GO:0008582 | regulation of synaptic growth at neuromuscular junction | IEA | Synap (GO term level: 12) | - |
GO:0007528 | neuromuscular junction development | IEA | Synap (GO term level: 10) | - |
GO:0045213 | neurotransmitter receptor metabolic process | IEA | Synap, Neurotransmitter (GO term level: 7) | - |
GO:0007213 | acetylcholine receptor signaling, muscarinic pathway | TAS | 9405491 | |
GO:0007165 | signal transduction | TAS | 9652404 | |
GO:0008033 | tRNA processing | IEA | - | |
GO:0007009 | plasma membrane organization | IEA | - | |
GO:0043113 | receptor clustering | IDA | 15340048 | |
GO:0043113 | receptor clustering | IMP | 9151673 | |
GO:0045944 | positive regulation of transcription from RNA polymerase II promoter | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005576 | extracellular region | IEA | - | |
GO:0005578 | proteinaceous extracellular matrix | IEA | - | |
GO:0005605 | basal lamina | IDA | 9405491 | |
GO:0005615 | extracellular space | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0009986 | cell surface | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG ECM RECEPTOR INTERACTION | 84 | 53 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME HS GAG DEGRADATION | 20 | 15 | All SZGR 2.0 genes in this pathway |
REACTOME CHONDROITIN SULFATE DERMATAN SULFATE METABOLISM | 49 | 33 | All SZGR 2.0 genes in this pathway |
REACTOME HS GAG BIOSYNTHESIS | 31 | 17 | All SZGR 2.0 genes in this pathway |
REACTOME HEPARAN SULFATE HEPARIN HS GAG METABOLISM | 52 | 33 | All SZGR 2.0 genes in this pathway |
REACTOME GLYCOSAMINOGLYCAN METABOLISM | 111 | 69 | All SZGR 2.0 genes in this pathway |
REACTOME A TETRASACCHARIDE LINKER SEQUENCE IS REQUIRED FOR GAG SYNTHESIS | 25 | 17 | All SZGR 2.0 genes in this pathway |
REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
REACTOME NCAM1 INTERACTIONS | 39 | 27 | All SZGR 2.0 genes in this pathway |
REACTOME NCAM SIGNALING FOR NEURITE OUT GROWTH | 64 | 49 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF CARBOHYDRATES | 247 | 154 | All SZGR 2.0 genes in this pathway |
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN | 634 | 384 | All SZGR 2.0 genes in this pathway |
WATANABE RECTAL CANCER RADIOTHERAPY RESPONSIVE DN | 92 | 51 | All SZGR 2.0 genes in this pathway |
GARY CD5 TARGETS UP | 473 | 314 | All SZGR 2.0 genes in this pathway |
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN | 335 | 193 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 1 DN | 242 | 165 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 2 DN | 281 | 186 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION CDC25 DN | 153 | 100 | All SZGR 2.0 genes in this pathway |
MARKEY RB1 ACUTE LOF UP | 215 | 137 | All SZGR 2.0 genes in this pathway |
EBAUER TARGETS OF PAX3 FOXO1 FUSION UP | 207 | 128 | All SZGR 2.0 genes in this pathway |
PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
OXFORD RALA OR RALB TARGETS DN | 24 | 17 | All SZGR 2.0 genes in this pathway |
LI WILMS TUMOR VS FETAL KIDNEY 2 DN | 51 | 42 | All SZGR 2.0 genes in this pathway |
LIANG HEMATOPOIESIS STEM CELL NUMBER SMALL VS HUGE UP | 38 | 29 | All SZGR 2.0 genes in this pathway |
GROSS HYPOXIA VIA ELK3 AND HIF1A DN | 103 | 71 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
LIAO METASTASIS | 539 | 324 | All SZGR 2.0 genes in this pathway |
TAGHAVI NEOPLASTIC TRANSFORMATION | 12 | 10 | All SZGR 2.0 genes in this pathway |
AMIT EGF RESPONSE 480 HELA | 164 | 118 | All SZGR 2.0 genes in this pathway |
SUNG METASTASIS STROMA UP | 110 | 70 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
ROSS AML WITH PML RARA FUSION | 77 | 62 | All SZGR 2.0 genes in this pathway |
LIN APC TARGETS | 77 | 55 | All SZGR 2.0 genes in this pathway |
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD DN | 162 | 102 | All SZGR 2.0 genes in this pathway |
LI WILMS TUMOR VS FETAL KIDNEY 1 UP | 182 | 119 | All SZGR 2.0 genes in this pathway |
BENNETT SYSTEMIC LUPUS ERYTHEMATOSUS | 31 | 21 | All SZGR 2.0 genes in this pathway |
RADMACHER AML PROGNOSIS | 78 | 52 | All SZGR 2.0 genes in this pathway |
RAMASWAMY METASTASIS DN | 61 | 47 | All SZGR 2.0 genes in this pathway |
ULE SPLICING VIA NOVA2 | 43 | 38 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
DASU IL6 SIGNALING SCAR UP | 30 | 21 | All SZGR 2.0 genes in this pathway |
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN | 287 | 208 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
ZHONG SECRETOME OF LUNG CANCER AND MACROPHAGE | 77 | 50 | All SZGR 2.0 genes in this pathway |
ZHONG SECRETOME OF LUNG CANCER AND FIBROBLAST | 132 | 93 | All SZGR 2.0 genes in this pathway |
FOSTER TOLERANT MACROPHAGE DN | 409 | 268 | All SZGR 2.0 genes in this pathway |
HELLER SILENCED BY METHYLATION UP | 282 | 183 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS UP | 317 | 208 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS SILENCED BY METHYLATION UP | 461 | 298 | All SZGR 2.0 genes in this pathway |
AMUNDSON POOR SURVIVAL AFTER GAMMA RADIATION 2G | 171 | 96 | All SZGR 2.0 genes in this pathway |
LEE LIVER CANCER SURVIVAL DN | 175 | 103 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH T 8 21 TRANSLOCATION | 368 | 247 | All SZGR 2.0 genes in this pathway |
DASU IL6 SIGNALING UP | 59 | 44 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP B | 549 | 316 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP C | 92 | 60 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
ALFANO MYC TARGETS | 239 | 156 | All SZGR 2.0 genes in this pathway |
PHONG TNF RESPONSE VIA P38 COMPLETE | 227 | 151 | All SZGR 2.0 genes in this pathway |
PHONG TNF RESPONSE VIA P38 PARTIAL | 160 | 106 | All SZGR 2.0 genes in this pathway |
NABA ECM GLYCOPROTEINS | 196 | 99 | All SZGR 2.0 genes in this pathway |
NABA CORE MATRISOME | 275 | 148 | All SZGR 2.0 genes in this pathway |
NABA BASEMENT MEMBRANES | 40 | 22 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-128 | 471 | 477 | 1A | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-144 | 469 | 475 | m8 | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
miR-27 | 471 | 477 | m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.