Gene Page: ARL1
Summary ?
| GeneID | 400 |
| Symbol | ARL1 |
| Synonyms | ARFL1 |
| Description | ADP ribosylation factor like GTPase 1 |
| Reference | MIM:603425|HGNC:HGNC:692|Ensembl:ENSG00000120805|HPRD:04574|Vega:OTTHUMG00000170271 |
| Gene type | protein-coding |
| Map location | 12q23.2 |
| Pascal p-value | 0.135 |
| Sherlock p-value | 0.582 |
| Fetal beta | -1.856 |
| DMG | 1 (# studies) |
| eGene | Cerebellar Hemisphere Nucleus accumbens basal ganglia Meta |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0032 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg20866788 | 12 | 101802016 | ARL1 | 2.88E-8 | -0.009 | 8.9E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| PSMA2 | 0.91 | 0.89 |
| TBCA | 0.91 | 0.89 |
| RBM34 | 0.91 | 0.89 |
| ERH | 0.90 | 0.91 |
| TMSB10 | 0.89 | 0.91 |
| SARNP | 0.89 | 0.88 |
| GLRX3 | 0.89 | 0.91 |
| DPY30 | 0.88 | 0.87 |
| POLB | 0.88 | 0.88 |
| DPH5 | 0.88 | 0.89 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.2 | -0.64 | -0.74 |
| AF347015.15 | -0.63 | -0.73 |
| AF347015.26 | -0.63 | -0.73 |
| AF347015.33 | -0.63 | -0.71 |
| MT-CYB | -0.63 | -0.71 |
| AF347015.8 | -0.62 | -0.70 |
| AF347015.27 | -0.62 | -0.70 |
| MT-CO2 | -0.61 | -0.67 |
| TINAGL1 | -0.60 | -0.69 |
| SLC6A12 | -0.60 | -0.69 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0003924 | GTPase activity | TAS | 9624189 | |
| GO:0005515 | protein binding | IPI | 17353931 | |
| GO:0005525 | GTP binding | IEA | - | |
| GO:0008047 | enzyme activator activity | TAS | 9624189 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007264 | small GTPase mediated signal transduction | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005794 | Golgi apparatus | IDA | 11256614 | |
| GO:0005622 | intracellular | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| ONKEN UVEAL MELANOMA DN | 526 | 357 | All SZGR 2.0 genes in this pathway |
| NAM FXYD5 TARGETS DN | 18 | 11 | All SZGR 2.0 genes in this pathway |
| GAZDA DIAMOND BLACKFAN ANEMIA PROGENITOR DN | 66 | 42 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| BORCZUK MALIGNANT MESOTHELIOMA UP | 305 | 185 | All SZGR 2.0 genes in this pathway |
| BARRIER COLON CANCER RECURRENCE UP | 42 | 28 | All SZGR 2.0 genes in this pathway |
| CHOW RASSF1 TARGETS DN | 29 | 19 | All SZGR 2.0 genes in this pathway |
| SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
| NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
| BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
| BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
| DOUGLAS BMI1 TARGETS DN | 314 | 188 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP | 863 | 514 | All SZGR 2.0 genes in this pathway |
| SHARMA PILOCYTIC ASTROCYTOMA LOCATION UP | 25 | 12 | All SZGR 2.0 genes in this pathway |
| HOFFMANN LARGE TO SMALL PRE BII LYMPHOCYTE UP | 163 | 102 | All SZGR 2.0 genes in this pathway |
| DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| JUBAN TARGETS OF SPI1 AND FLI1 UP | 115 | 73 | All SZGR 2.0 genes in this pathway |
| FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-496 | 203 | 209 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
| miR-9 | 405 | 411 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.