Gene Page: LMX1A
Summary ?
| GeneID | 4009 |
| Symbol | LMX1A |
| Synonyms | LMX1|LMX1.1 |
| Description | LIM homeobox transcription factor 1 alpha |
| Reference | MIM:600298|HGNC:HGNC:6653|Ensembl:ENSG00000162761|HPRD:02623|Vega:OTTHUMG00000034575 |
| Gene type | protein-coding |
| Map location | 1q24.1 |
| Fetal beta | 0.37 |
| DMG | 2 (# studies) |
| eGene | Meta |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 3 |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 3 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 3 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg23971170 | 1 | 165326269 | LMX1A | 4.22E-5 | -0.686 | 0.021 | DMG:Wockner_2014 |
| cg22627981 | 1 | 165204410 | LMX1A | 4.317E-4 | -0.371 | 0.045 | DMG:Wockner_2014 |
| cg08606911 | 1 | 165325231 | LMX1A | 4.32E-9 | -0.015 | 2.58E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| ZNF276 | 0.92 | 0.92 |
| TYK2 | 0.88 | 0.87 |
| LRDD | 0.88 | 0.87 |
| TUBGCP6 | 0.88 | 0.88 |
| RHOT2 | 0.87 | 0.85 |
| IDUA | 0.86 | 0.86 |
| AC004410.1 | 0.86 | 0.87 |
| MYO9B | 0.85 | 0.86 |
| GIGYF1 | 0.85 | 0.87 |
| RTEL1 | 0.85 | 0.83 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.31 | -0.51 | -0.50 |
| CLEC2B | -0.51 | -0.60 |
| AF347015.21 | -0.50 | -0.56 |
| C1orf54 | -0.49 | -0.54 |
| GNG11 | -0.49 | -0.56 |
| GIMAP2 | -0.48 | -0.50 |
| CARD16 | -0.48 | -0.51 |
| B2M | -0.48 | -0.44 |
| NMI | -0.47 | -0.49 |
| LY96 | -0.47 | -0.56 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003677 | DNA binding | IEA | - | |
| GO:0003700 | transcription factor activity | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| GO:0043565 | sequence-specific DNA binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007417 | central nervous system development | IEA | Brain (GO term level: 6) | - |
| GO:0007411 | axon guidance | IEA | axon (GO term level: 13) | - |
| GO:0045665 | negative regulation of neuron differentiation | IEA | neuron (GO term level: 10) | - |
| GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
| GO:0007275 | multicellular organismal development | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KONDO PROSTATE CANCER HCP WITH H3K27ME3 | 97 | 72 | All SZGR 2.0 genes in this pathway |
| IWANAGA CARCINOGENESIS BY KRAS PTEN UP | 181 | 112 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K27ME3 | 269 | 159 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 | 349 | 234 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC HCP WITH H3K27ME3 | 341 | 243 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| let-7/98 | 914 | 921 | 1A,m8 | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
| hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
| hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
| hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
| hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
| hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
| hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
| hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
| hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
| miR-142-5p | 482 | 488 | m8 | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
| hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC | ||||
| miR-181 | 1918 | 1924 | 1A | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
| hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
| hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
| hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
| miR-29 | 1575 | 1581 | 1A | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
| hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
| hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
| miR-324-5p | 120 | 126 | m8 | hsa-miR-324-5p | CGCAUCCCCUAGGGCAUUGGUGU |
| miR-329 | 408 | 414 | 1A | hsa-miR-329brain | AACACACCUGGUUAACCUCUUU |
| miR-374 | 449 | 455 | 1A | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
| miR-377 | 1792 | 1798 | m8 | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
| hsa-miR-377 | AUCACACAAAGGCAACUUUUGU | ||||
| miR-494 | 195 | 201 | m8 | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
| miR-9 | 160 | 166 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
| miR-93.hd/291-3p/294/295/302/372/373/520 | 524 | 530 | 1A | hsa-miR-93brain | AAAGUGCUGUUCGUGCAGGUAG |
| hsa-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA | ||||
| hsa-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG | ||||
| hsa-miR-302c | UAAGUGCUUCCAUGUUUCAGUGG | ||||
| hsa-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU | ||||
| hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU | ||||
| hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU | ||||
| hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG | ||||
| hsa-miR-520a | AAAGUGCUUCCCUUUGGACUGU | ||||
| hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG | ||||
| hsa-miR-520c | AAAGUGCUUCCUUUUAGAGGGUU | ||||
| hsa-miR-520d | AAAGUGCUUCUCUUUGGUGGGUU | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.