Gene Page: MAP6
Summary ?
| GeneID | 4135 |
| Symbol | MAP6 |
| Synonyms | MAP6-N|MTAP6|N-STOP|STOP |
| Description | microtubule associated protein 6 |
| Reference | MIM:601783|HGNC:HGNC:6868|Ensembl:ENSG00000171533|HPRD:15989|Vega:OTTHUMG00000165343 |
| Gene type | protein-coding |
| Map location | 11q13.5 |
| Pascal p-value | 0.524 |
| Fetal beta | 2.088 |
| Support | STRUCTURAL PLASTICITY G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS CompositeSet |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Association | A combined odds ratio method (Sun et al. 2008), association studies | 1 | Link to SZGene |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| OTX2 | 0.81 | 0.17 |
| SP5 | 0.77 | 0.32 |
| CEACAM21 | 0.76 | 0.28 |
| MAB21L1 | 0.76 | 0.17 |
| ANO2 | 0.75 | 0.41 |
| TAL1 | 0.74 | 0.15 |
| KLK10 | 0.73 | 0.46 |
| ANXA3 | 0.70 | 0.20 |
| MAP4K1 | 0.70 | 0.23 |
| PODNL1 | 0.67 | 0.39 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| EMX2 | -0.20 | -0.35 |
| AF347015.2 | -0.19 | -0.18 |
| EMX1 | -0.19 | -0.10 |
| NFIX | -0.18 | -0.05 |
| MYH9 | -0.18 | -0.13 |
| RP4-697K14.1 | -0.18 | -0.27 |
| AF347015.18 | -0.18 | -0.16 |
| ANP32C | -0.17 | -0.30 |
| AC016705.1 | -0.17 | -0.15 |
| SMTN | -0.17 | -0.23 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005516 | calmodulin binding | IEA | - | |
| GO:0008017 | microtubule binding | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005794 | Golgi apparatus | IEA | - | |
| GO:0005856 | cytoskeleton | IEA | - | |
| GO:0005874 | microtubule | IEA | - | |
| GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
| CHIARADONNA NEOPLASTIC TRANSFORMATION CDC25 DN | 153 | 100 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| DARWICHE SKIN TUMOR PROMOTER UP | 142 | 96 | All SZGR 2.0 genes in this pathway |
| DARWICHE PAPILLOMA RISK LOW UP | 162 | 104 | All SZGR 2.0 genes in this pathway |
| DARWICHE PAPILLOMA RISK HIGH UP | 147 | 101 | All SZGR 2.0 genes in this pathway |
| DARWICHE SQUAMOUS CELL CARCINOMA DN | 181 | 107 | All SZGR 2.0 genes in this pathway |
| PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
| WANG RESPONSE TO BEXAROTENE DN | 29 | 19 | All SZGR 2.0 genes in this pathway |
| BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| NIKOLSKY BREAST CANCER 11Q12 Q14 AMPLICON | 158 | 93 | All SZGR 2.0 genes in this pathway |
| NUMATA CSF3 SIGNALING VIA STAT3 | 22 | 17 | All SZGR 2.0 genes in this pathway |
| AFFAR YY1 TARGETS UP | 214 | 133 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 2 | 473 | 224 | All SZGR 2.0 genes in this pathway |
| GAVIN FOXP3 TARGETS CLUSTER P7 | 90 | 52 | All SZGR 2.0 genes in this pathway |
| IWANAGA CARCINOGENESIS BY KRAS PTEN UP | 181 | 112 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-125/351 | 1668 | 1674 | m8 | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
| hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
| miR-29 | 2795 | 2802 | 1A,m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
| hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
| hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
| miR-299-5p | 61 | 67 | 1A | hsa-miR-299-5p | UGGUUUACCGUCCCACAUACAU |
| miR-30-5p | 2393 | 2400 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
| hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
| hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
| hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
| hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
| miR-335 | 2345 | 2351 | 1A | hsa-miR-335brain | UCAAGAGCAAUAACGAAAAAUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.