Gene Page: MAZ
Summary ?
| GeneID | 4150 |
| Symbol | MAZ |
| Synonyms | PUR1|Pur-1|SAF-1|SAF-2|SAF-3|ZF87|ZNF801|Zif87 |
| Description | MYC associated zinc finger protein |
| Reference | MIM:600999|HGNC:HGNC:6914|Ensembl:ENSG00000103495|HPRD:02999|Vega:OTTHUMG00000190393 |
| Gene type | protein-coding |
| Map location | 16p11.2 |
| Pascal p-value | 0.022 |
| Fetal beta | 0.051 |
| DMG | 1 (# studies) |
| Support | CompositeSet Darnell FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CNV:YES | Copy number variation studies | Manual curation | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01775 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg01383799 | 16 | 29819361 | MAZ | 3.003E-4 | 0.728 | 0.04 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| TRIP13 | 0.94 | 0.93 |
| RRM1 | 0.94 | 0.94 |
| NUP107 | 0.93 | 0.89 |
| TRA2B | 0.93 | 0.93 |
| NUP205 | 0.93 | 0.93 |
| DHX9 | 0.92 | 0.94 |
| POLD3 | 0.92 | 0.91 |
| MSH6 | 0.92 | 0.93 |
| SFRS3 | 0.92 | 0.92 |
| SUV39H2 | 0.92 | 0.88 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| HLA-F | -0.74 | -0.85 |
| AF347015.33 | -0.72 | -0.90 |
| AF347015.27 | -0.72 | -0.89 |
| AF347015.31 | -0.71 | -0.89 |
| MT-CO2 | -0.71 | -0.91 |
| AIFM3 | -0.71 | -0.80 |
| FXYD1 | -0.70 | -0.88 |
| S100B | -0.70 | -0.84 |
| MT-CYB | -0.70 | -0.89 |
| AF347015.8 | -0.69 | -0.90 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003676 | nucleic acid binding | IEA | - | |
| GO:0003677 | DNA binding | IEA | - | |
| GO:0003723 | RNA binding | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
| GO:0006367 | transcription initiation from RNA polymerase II promoter | TAS | 1502157 | |
| GO:0006369 | termination of RNA polymerase II transcription | TAS | 1502157 | |
| GO:0006350 | transcription | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005622 | intracellular | IEA | - | |
| GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| PARENT MTOR SIGNALING UP | 567 | 375 | All SZGR 2.0 genes in this pathway |
| GARY CD5 TARGETS UP | 473 | 314 | All SZGR 2.0 genes in this pathway |
| PUIFFE INVASION INHIBITED BY ASCITES UP | 82 | 51 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
| KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
| ELVIDGE HYPOXIA DN | 146 | 94 | All SZGR 2.0 genes in this pathway |
| RASHI RESPONSE TO IONIZING RADIATION 6 | 84 | 54 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER SERUM RESPONSE AUGMENTED BY MYC | 108 | 74 | All SZGR 2.0 genes in this pathway |
| PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 UP | 309 | 199 | All SZGR 2.0 genes in this pathway |
| MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA2 PCC NETWORK | 423 | 265 | All SZGR 2.0 genes in this pathway |
| LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
| BALDWIN PRKCI TARGETS UP | 35 | 26 | All SZGR 2.0 genes in this pathway |
| MANALO HYPOXIA DN | 289 | 166 | All SZGR 2.0 genes in this pathway |
| BROCKE APOPTOSIS REVERSED BY IL6 | 144 | 98 | All SZGR 2.0 genes in this pathway |
| PENG GLUTAMINE DEPRIVATION DN | 337 | 230 | All SZGR 2.0 genes in this pathway |
| ZHAN MULTIPLE MYELOMA SUBGROUPS | 30 | 20 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 48HR DN | 504 | 323 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 18HR DN | 178 | 121 | All SZGR 2.0 genes in this pathway |
| ZAMORA NOS2 TARGETS DN | 96 | 71 | All SZGR 2.0 genes in this pathway |
| MARIADASON RESPONSE TO BUTYRATE SULINDAC 6 | 52 | 32 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
| JIANG TIP30 TARGETS DN | 24 | 14 | All SZGR 2.0 genes in this pathway |
| FRASOR RESPONSE TO SERM OR FULVESTRANT DN | 50 | 29 | All SZGR 2.0 genes in this pathway |
| HSIAO HOUSEKEEPING GENES | 389 | 245 | All SZGR 2.0 genes in this pathway |
| CAIRO HEPATOBLASTOMA CLASSES UP | 605 | 377 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 1HR UP | 61 | 44 | All SZGR 2.0 genes in this pathway |
| MARTENS TRETINOIN RESPONSE DN | 841 | 431 | All SZGR 2.0 genes in this pathway |
| KASLER HDAC7 TARGETS 1 UP | 194 | 133 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-29 | 416 | 422 | m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
| hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
| hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
| miR-331 | 446 | 452 | m8 | hsa-miR-331brain | GCCCCUGGGCCUAUCCUAGAA |
| miR-34/449 | 280 | 286 | m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
| hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
| hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
| hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
| miR-505 | 229 | 236 | 1A,m8 | hsa-miR-505 | GUCAACACUUGCUGGUUUCCUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.