SZGR2

Summary ?

GeneID	4661
Symbol	MYT1
Synonyms	C20orf36\|MTF1\|MYTI\|NZF2\|PLPB1\|ZC2HC4A
Description	myelin transcription factor 1
Reference	MIM:600379\|HGNC:HGNC:7622\|Ensembl:ENSG00000196132\|HPRD:02659\|Vega:OTTHUMG00000149988
Gene type	protein-coding
Map location	20q13.33
Pascal p-value	0.242
Sherlock p-value	0.594
Fetal beta	1.537
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Expression	Meta-analysis of gene expression	P value: 1.735
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg21910489	20	62818388	MYT1	1.51E-5	0.544	0.015	DMG:Wockner_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs6687849	chr1	175904808	MYT1	4661	0.09	trans
rs2481653	chr1	176044120	MYT1	4661	0.12	trans
rs2502827	chr1	176044216	MYT1	4661	0	trans
rs17572651	chr1	218943612	MYT1	4661	0.14	trans
rs16829545	chr2	151977407	MYT1	4661	1.62E-16	trans
rs16841750	chr2	158288461	MYT1	4661	0.06	trans
rs3845734	chr2	171125572	MYT1	4661	1.358E-4	trans
rs7584986	chr2	184111432	MYT1	4661	1.121E-9	trans
rs16889813	chr4	14196540	MYT1	4661	0.17	trans
rs2183142	chr4	159232695	MYT1	4661	0.09	trans
rs1396222	chr4	173279496	MYT1	4661	0.15	trans
rs335980	chr4	173329784	MYT1	4661	0.14	trans
rs337984	chr4	173411662	MYT1	4661	0.16	trans
rs17762315	chr5	76807576	MYT1	4661	0.02	trans
rs16890367	chr6	38078448	MYT1	4661	0.17	trans
rs3118341	chr9	25185518	MYT1	4661	0.01	trans
rs11139334	chr9	84209393	MYT1	4661	0.13	trans
rs2393316	chr10	59333070	MYT1	4661	0.11	trans
rs17104720	chr14	77127308	MYT1	4661	0.18	trans
rs16955618	chr15	29937543	MYT1	4661	2.458E-29	trans
rs1041786	chr21	22617710	MYT1	4661	1.327E-5	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	IEA		-
GO:0003700	transcription factor activity	NAS		1280325
GO:0005515	protein binding	IPI		9001210
GO:0008270	zinc ion binding	IEA		-
GO:0008270	zinc ion binding	NAS		1280325
GO:0046872	metal ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007399	nervous system development	IEA	neurite (GO term level: 5)	-
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006355	regulation of transcription, DNA-dependent	NAS		1280325
GO:0006350	transcription	IEA		-
GO:0007275	multicellular organismal development	IEA		-
GO:0030154	cell differentiation	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0005634	nucleus	NAS		1280325

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BIOCARTA G2 PATHWAY	24	20	All SZGR 2.0 genes in this pathway
BIOCARTA MPR PATHWAY	34	28	All SZGR 2.0 genes in this pathway
BIOCARTA RB PATHWAY	13	11	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN	164	111	All SZGR 2.0 genes in this pathway
SCHLESINGER H3K27ME3 IN NORMAL AND METHYLATED IN CANCER	28	21	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS DN	357	212	All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 20Q12 Q13 AMPLICON	149	76	All SZGR 2.0 genes in this pathway
MODY HIPPOCAMPUS PRENATAL	42	33	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN	353	226	All SZGR 2.0 genes in this pathway
MOLENAAR TARGETS OF CCND1 AND CDK4 UP	67	48	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL B UP	172	109	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN	701	446	All SZGR 2.0 genes in this pathway
ZHOU PANCREATIC ENDOCRINE PROGENITOR	14	11	All SZGR 2.0 genes in this pathway
VANASSE BCL2 TARGETS UP	40	25	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL	177	132	All SZGR 2.0 genes in this pathway
CARD MIR302A TARGETS	77	62	All SZGR 2.0 genes in this pathway
DORMOY ELAVL1 TARGETS	17	10	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-125/351	308	315	1A,m8	hsa-miR-125b^brain	UCCCUGAGACCCUAACUUGUGA
miR-125/351	308	315	1A,m8	hsa-miR-125a^brain	UCCCUGAGACCCUUUAACCUGUG
miR-128	1708	1714	1A	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	1708	1714	1A	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-130/301	1052	1058	m8	hsa-miR-130a^brain	CAGUGCAAUGUUAAAAGGGCAU
				hsa-miR-301	CAGUGCAAUAGUAUUGUCAAAGC
				hsa-miR-130b^brain	CAGUGCAAUGAUGAAAGGGCAU
				hsa-miR-454-3p	UAGUGCAAUAUUGCUUAUAGGGUUU
miR-144	1706	1712	m8	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-146	305	311	1A	hsa-miR-146a	UGAGAACUGAAUUCCAUGGGUU
miR-146	305	311	1A	hsa-miR-146b^brain	UGAGAACUGAAUUCCAUAGGCU
miR-186	1360	1366	m8	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-200bc/429	336	342	m8	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-27	1708	1714	m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	1708	1714	m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-329	1757	1763	m8	hsa-miR-329^brain	AACACACCUGGUUAACCUCUUU
miR-378	1725	1731	1A	hsa-miR-378	CUCCUGACUCCAGGUCCUGUGU
miR-410	1342	1348	1A	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-495	1350	1356	1A	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: MYT1