Gene Page: NSF
Summary ?
| GeneID | 4905 |
| Symbol | NSF |
| Synonyms | SKD2 |
| Description | N-ethylmaleimide sensitive factor |
| Reference | MIM:601633|HGNC:HGNC:8016|Ensembl:ENSG00000073969|HPRD:03380|Vega:OTTHUMG00000134315 |
| Gene type | protein-coding |
| Map location | 17q21 |
| Pascal p-value | 8.39E-4 |
| Sherlock p-value | 0.906 |
| Fetal beta | -2.359 |
| DMG | 1 (# studies) |
| eGene | Cerebellar Hemisphere |
| Support | CANABINOID DOPAMINE EXOCYTOSIS METABOTROPIC GLUTAMATE RECEPTOR SEROTONIN G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.human_mGluR5 G2Cdb.human_TAP-PSD-95-CORE G2Cdb.humanNRC CompositeSet Darnell FMRP targets Potential synaptic genes |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 1.3048 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg19876689 | 17 | 44799518 | NSF | 2.55E-5 | 0.322 | 0.017 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0000287 | magnesium ion binding | IEA | - | |
| GO:0005515 | protein binding | IPI | 17353931 | |
| GO:0005524 | ATP binding | IEA | - | |
| GO:0016787 | hydrolase activity | IEA | - | |
| GO:0017111 | nucleoside-triphosphatase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0015031 | protein transport | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005737 | cytoplasm | IEA | - |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| ARRB1 | ARB1 | ARR1 | arrestin, beta 1 | - | HPRD,BioGRID | 10196135 |
| C14orf1 | ERG28 | NET51 | chromosome 14 open reading frame 1 | Two-hybrid | BioGRID | 16169070 |
| CD28 | MGC138290 | Tp44 | CD28 molecule | CD28 interacts with NSF. | BIND | 11680900 |
| EEA1 | MST105 | MSTP105 | ZFYVE2 | early endosome antigen 1 | Co-fractionation | BioGRID | 10458612 |
| EIF3E | EIF3-P48 | EIF3S6 | INT6 | eIF3-p46 | eukaryotic translation initiation factor 3, subunit E | Two-hybrid | BioGRID | 16169070 |
| FUNDC2 | DC44 | FLJ33773 | HCBP6 | HCC3 | MGC131676 | MGC2495 | PD03104 | FUN14 domain containing 2 | Two-hybrid | BioGRID | 16169070 |
| GABARAP | FLJ25768 | MGC120154 | MGC120155 | MM46 | GABA(A) receptor-associated protein | - | HPRD | 11461150 |
| GABARAPL2 | ATG8 | GATE-16 | GATE16 | GEF-2 | GEF2 | GABA(A) receptor-associated protein-like 2 | - | HPRD | 10747018 |
| GOSR1 | GOLIM2 | GOS-28 | GOS28 | GOS28/P28 | GS28 | P28 | golgi SNAP receptor complex member 1 | - | HPRD | 8636227 |9325254 |
| KIAA1377 | - | KIAA1377 | Two-hybrid | BioGRID | 16169070 |
| LUC7L2 | CGI-59 | CGI-74 | FLJ10657 | LUC7B2 | LUC7-like 2 (S. cerevisiae) | Two-hybrid | BioGRID | 16169070 |
| NAPA | SNAPA | N-ethylmaleimide-sensitive factor attachment protein, alpha | - | HPRD,BioGRID | 9362506 |
| NSF | SKD2 | N-ethylmaleimide-sensitive factor | - | HPRD,BioGRID | 8051214 |
| RGS20 | RGSZ1 | ZGAP1 | regulator of G-protein signaling 20 | Affinity Capture-MS | BioGRID | 17353931 |
| RPLP1 | FLJ27448 | MGC5215 | P1 | RPP1 | ribosomal protein, large, P1 | Two-hybrid | BioGRID | 16169070 |
| SAP18 | 2HOR0202 | MGC27131 | SAP18p | Sin3A-associated protein, 18kDa | Affinity Capture-MS | BioGRID | 17353931 |
| STX1A | HPC-1 | STX1 | p35-1 | syntaxin 1A (brain) | - | HPRD | 7622514 |
| STX4 | STX4A | p35-2 | syntaxin 4 | - | HPRD | 8973549 |
| STX8 | CARB | syntaxin 8 | - | HPRD | 10683148 |
| USO1 | P115 | TAP | VDP | USO1 homolog, vesicle docking protein (yeast) | - | HPRD | 10903204 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG VASOPRESSIN REGULATED WATER REABSORPTION | 44 | 30 | All SZGR 2.0 genes in this pathway |
| REACTOME TRANSMISSION ACROSS CHEMICAL SYNAPSES | 186 | 155 | All SZGR 2.0 genes in this pathway |
| REACTOME NEURONAL SYSTEM | 279 | 221 | All SZGR 2.0 genes in this pathway |
| REACTOME NEUROTRANSMITTER RECEPTOR BINDING AND DOWNSTREAM TRANSMISSION IN THE POSTSYNAPTIC CELL | 137 | 110 | All SZGR 2.0 genes in this pathway |
| REACTOME TRAFFICKING OF AMPA RECEPTORS | 28 | 23 | All SZGR 2.0 genes in this pathway |
| REACTOME TRAFFICKING OF GLUR2 CONTAINING AMPA RECEPTORS | 16 | 11 | All SZGR 2.0 genes in this pathway |
| GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID UP | 25 | 18 | All SZGR 2.0 genes in this pathway |
| BILBAN B CLL LPL UP | 63 | 39 | All SZGR 2.0 genes in this pathway |
| TIEN INTESTINE PROBIOTICS 24HR UP | 557 | 331 | All SZGR 2.0 genes in this pathway |
| JOHANSSON BRAIN CANCER EARLY VS LATE DN | 45 | 35 | All SZGR 2.0 genes in this pathway |
| SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
| NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
| LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
| RICKMAN TUMOR DIFFERENTIATED MODERATELY VS POORLY UP | 121 | 71 | All SZGR 2.0 genes in this pathway |
| GEORGES TARGETS OF MIR192 AND MIR215 | 893 | 528 | All SZGR 2.0 genes in this pathway |
| SAKAI TUMOR INFILTRATING MONOCYTES UP | 27 | 19 | All SZGR 2.0 genes in this pathway |
| MENSSEN MYC TARGETS | 53 | 35 | All SZGR 2.0 genes in this pathway |
| KAAB HEART ATRIUM VS VENTRICLE UP | 249 | 170 | All SZGR 2.0 genes in this pathway |
| CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
| JIANG AGING CEREBRAL CORTEX DN | 54 | 43 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
| MARTINEZ TP53 TARGETS UP | 602 | 364 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 AND TP53 TARGETS UP | 601 | 369 | All SZGR 2.0 genes in this pathway |
| IWANAGA CARCINOGENESIS BY KRAS PTEN DN | 353 | 226 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER CANCER WITH H3K9ME3 DN | 120 | 71 | All SZGR 2.0 genes in this pathway |
| BERNARD PPAPDC1B TARGETS DN | 58 | 39 | All SZGR 2.0 genes in this pathway |
| MOOTHA PGC | 420 | 269 | All SZGR 2.0 genes in this pathway |
| LEE LIVER CANCER SURVIVAL DN | 175 | 103 | All SZGR 2.0 genes in this pathway |
| AGUIRRE PANCREATIC CANCER COPY NUMBER UP | 298 | 174 | All SZGR 2.0 genes in this pathway |
| BOYAULT LIVER CANCER SUBCLASS G3 UP | 188 | 121 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
| KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
| TERAO AOX4 TARGETS HG UP | 28 | 20 | All SZGR 2.0 genes in this pathway |
| HUANG GATA2 TARGETS DN | 72 | 52 | All SZGR 2.0 genes in this pathway |
| FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-1/206 | 1011 | 1017 | 1A | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
| hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
| hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
| miR-224 | 895 | 901 | 1A | hsa-miR-224 | CAAGUCACUAGUGGUUCCGUUUA |
| miR-25/32/92/363/367 | 1614 | 1620 | 1A | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
| hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
| hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
| hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
| hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
| miR-33 | 1612 | 1618 | 1A | hsa-miR-33 | GUGCAUUGUAGUUGCAUUG |
| hsa-miR-33b | GUGCAUUGCUGUUGCAUUGCA | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.