Gene Page: NR4A2
Summary ?
GeneID | 4929 |
Symbol | NR4A2 |
Synonyms | HZF-3|NOT|NURR1|RNR1|TINUR |
Description | nuclear receptor subfamily 4 group A member 2 |
Reference | MIM:601828|HGNC:HGNC:7981|Ensembl:ENSG00000153234|HPRD:03493|Vega:OTTHUMG00000131950 |
Gene type | protein-coding |
Map location | 2q22-q23 |
Pascal p-value | 0.055 |
Sherlock p-value | 0.682 |
Fetal beta | 1.403 |
DMG | 2 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 3 |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 3 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Association | A combined odds ratio method (Sun et al. 2008), association studies | 2 | Link to SZGene |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02395 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 3 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg06101180 | 2 | 157185558 | NR4A2 | 4.541E-4 | 0.405 | 0.045 | DMG:Wockner_2014 |
cg03953709 | 2 | 157189668 | NR4A2 | 6.96E-10 | -0.012 | 9.72E-7 | DMG:Jaffe_2016 |
cg21512275 | 2 | 157198069 | NR4A2 | 6.58E-9 | -0.011 | 3.39E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](/SZGR/GeneImg/NR4A2_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | IEA | - | |
GO:0003707 | steroid hormone receptor activity | IEA | - | |
GO:0005515 | protein binding | IEA | - | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
GO:0043565 | sequence-specific DNA binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0030182 | neuron differentiation | IEA | neuron (GO term level: 8) | - |
GO:0042053 | regulation of dopamine metabolic process | IEA | dopamine (GO term level: 9) | - |
GO:0007399 | nervous system development | IEA | neurite (GO term level: 5) | - |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0006350 | transcription | IEA | - | |
GO:0007165 | signal transduction | NAS | 7877627 | |
GO:0045944 | positive regulation of transcription from RNA polymerase II promoter | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | TAS | 7877627 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME GENERIC TRANSCRIPTION PATHWAY | 352 | 181 | All SZGR 2.0 genes in this pathway |
REACTOME NUCLEAR RECEPTOR TRANSCRIPTION PATHWAY | 49 | 36 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR MARKERS DN | 20 | 14 | All SZGR 2.0 genes in this pathway |
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN | 634 | 384 | All SZGR 2.0 genes in this pathway |
PICCALUGA ANGIOIMMUNOBLASTIC LYMPHOMA DN | 136 | 86 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
TURASHVILI BREAST NORMAL DUCTAL VS LOBULAR UP | 68 | 40 | All SZGR 2.0 genes in this pathway |
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA UP | 177 | 110 | All SZGR 2.0 genes in this pathway |
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL UP | 233 | 161 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 6HR DN | 41 | 29 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D UP | 157 | 91 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 10D UP | 194 | 122 | All SZGR 2.0 genes in this pathway |
LOPEZ MESOTELIOMA SURVIVAL TIME DN | 7 | 7 | All SZGR 2.0 genes in this pathway |
RHEIN ALL GLUCOCORTICOID THERAPY UP | 78 | 41 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION MONOCYTE DN | 54 | 38 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
NAGASHIMA NRG1 SIGNALING UP | 176 | 123 | All SZGR 2.0 genes in this pathway |
NAGASHIMA EGF SIGNALING UP | 58 | 40 | All SZGR 2.0 genes in this pathway |
GRAHAM CML QUIESCENT VS NORMAL DIVIDING UP | 57 | 33 | All SZGR 2.0 genes in this pathway |
GRAHAM NORMAL QUIESCENT VS NORMAL DIVIDING UP | 66 | 47 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN | 537 | 339 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
VANHARANTA UTERINE FIBROID DN | 67 | 45 | All SZGR 2.0 genes in this pathway |
RIZ ERYTHROID DIFFERENTIATION HBZ | 41 | 27 | All SZGR 2.0 genes in this pathway |
RIZ ERYTHROID DIFFERENTIATION HEMGN | 31 | 21 | All SZGR 2.0 genes in this pathway |
RIZ ERYTHROID DIFFERENTIATION 6HR | 40 | 23 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
AMIT EGF RESPONSE 60 HELA | 46 | 32 | All SZGR 2.0 genes in this pathway |
AMIT SERUM RESPONSE 40 MCF10A | 32 | 21 | All SZGR 2.0 genes in this pathway |
AMIT SERUM RESPONSE 60 MCF10A | 57 | 42 | All SZGR 2.0 genes in this pathway |
LE EGR2 TARGETS DN | 108 | 84 | All SZGR 2.0 genes in this pathway |
YAGI AML FAB MARKERS | 191 | 131 | All SZGR 2.0 genes in this pathway |
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP | 314 | 201 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL | 254 | 164 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV NHEK UP | 244 | 151 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS PEAK AT 2HR | 51 | 36 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS 1 | 33 | 24 | All SZGR 2.0 genes in this pathway |
DAZARD UV RESPONSE CLUSTER G1 | 67 | 41 | All SZGR 2.0 genes in this pathway |
SAFFORD T LYMPHOCYTE ANERGY | 87 | 54 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
ZHENG BOUND BY FOXP3 | 491 | 310 | All SZGR 2.0 genes in this pathway |
ZHENG FOXP3 TARGETS IN THYMUS DN | 12 | 9 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS UP | 317 | 208 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS SILENCED BY METHYLATION UP | 461 | 298 | All SZGR 2.0 genes in this pathway |
WALLACE PROSTATE CANCER RACE UP | 299 | 167 | All SZGR 2.0 genes in this pathway |
RIZKI TUMOR INVASIVENESS 3D UP | 210 | 124 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER DN | 540 | 340 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE DN | 274 | 165 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
BLUM RESPONSE TO SALIRASIB DN | 342 | 220 | All SZGR 2.0 genes in this pathway |
WU ALZHEIMER DISEASE DN | 19 | 12 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS DN | 366 | 257 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO CSF2RB AND IL4 DN | 315 | 201 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF DN | 235 | 144 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 UP | 408 | 276 | All SZGR 2.0 genes in this pathway |
LEE SP4 THYMOCYTE | 14 | 11 | All SZGR 2.0 genes in this pathway |
LEE RECENT THYMIC EMIGRANT | 227 | 128 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
LIU VAV3 PROSTATE CARCINOGENESIS DN | 17 | 14 | All SZGR 2.0 genes in this pathway |
CROONQUIST STROMAL STIMULATION UP | 60 | 42 | All SZGR 2.0 genes in this pathway |
CROONQUIST NRAS VS STROMAL STIMULATION DN | 99 | 65 | All SZGR 2.0 genes in this pathway |
VALK AML CLUSTER 1 | 28 | 19 | All SZGR 2.0 genes in this pathway |
PYEON CANCER HEAD AND NECK VS CERVICAL UP | 193 | 95 | All SZGR 2.0 genes in this pathway |
GUTIERREZ WALDENSTROEMS MACROGLOBULINEMIA 1 DN | 9 | 7 | All SZGR 2.0 genes in this pathway |
UZONYI RESPONSE TO LEUKOTRIENE AND THROMBIN | 37 | 26 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 2HR UP | 39 | 30 | All SZGR 2.0 genes in this pathway |
WINZEN DEGRADED VIA KHSRP | 100 | 70 | All SZGR 2.0 genes in this pathway |
PEDERSEN METASTASIS BY ERBB2 ISOFORM 5 | 11 | 8 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 SIGNALING VIA NFIC 1HR UP | 33 | 25 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 SIGNALING VIA NFIC 10HR DN | 30 | 25 | All SZGR 2.0 genes in this pathway |
WANG MLL TARGETS | 289 | 188 | All SZGR 2.0 genes in this pathway |
PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
SMIRNOV RESPONSE TO IR 6HR DN | 114 | 69 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 3 TRANSIENTLY INDUCED BY EGF | 222 | 159 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-1/206 | 902 | 908 | m8 | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
miR-129-5p | 643 | 650 | 1A,m8 | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
miR-132/212 | 1014 | 1020 | m8 | hsa-miR-212SZ | UAACAGUCUCCAGUCACGGCC |
hsa-miR-132brain | UAACAGUCUACAGCCAUGGUCG | ||||
miR-17-5p/20/93.mr/106/519.d | 1064 | 1070 | m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-183 | 1136 | 1142 | 1A | hsa-miR-183 | UAUGGCACUGGUAGAAUUCACUG |
miR-186 | 1251 | 1257 | m8 | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
miR-204/211 | 870 | 876 | m8 | hsa-miR-204brain | UUCCCUUUGUCAUCCUAUGCCU |
hsa-miR-211 | UUCCCUUUGUCAUCCUUCGCCU | ||||
miR-217 | 567 | 573 | m8 | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU |
miR-30-5p | 1279 | 1286 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-320 | 1006 | 1012 | m8 | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
miR-33 | 565 | 571 | m8 | hsa-miR-33 | GUGCAUUGUAGUUGCAUUG |
hsa-miR-33b | GUGCAUUGCUGUUGCAUUGCA | ||||
miR-34/449 | 1193 | 1199 | m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
miR-34b | 1194 | 1200 | m8 | hsa-miR-34b | UAGGCAGUGUCAUUAGCUGAUUG |
miR-361 | 1243 | 1250 | 1A,m8 | hsa-miR-361brain | UUAUCAGAAUCUCCAGGGGUAC |
miR-365 | 211 | 217 | m8 | hsa-miR-365 | UAAUGCCCCUAAAAAUCCUUAU |
miR-369-3p | 737 | 743 | 1A | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
miR-374 | 737 | 743 | m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
miR-376c | 762 | 768 | 1A | hsa-miR-376c | AACAUAGAGGAAAUUCCACG |
miR-381 | 1160 | 1166 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
miR-409-3p | 901 | 907 | m8 | hsa-miR-409-3p | CGAAUGUUGCUCGGUGAACCCCU |
miR-410 | 739 | 745 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
miR-450 | 643 | 649 | 1A | hsa-miR-450 | UUUUUGCGAUGUGUUCCUAAUA |
miR-455 | 1177 | 1183 | m8 | hsa-miR-455 | UAUGUGCCUUUGGACUACAUCG |
miR-539 | 815 | 821 | 1A | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
miR-93.hd/291-3p/294/295/302/372/373/520 | 1063 | 1069 | m8 | hsa-miR-93brain | AAAGUGCUGUUCGUGCAGGUAG |
hsa-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA | ||||
hsa-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG | ||||
hsa-miR-302c | UAAGUGCUUCCAUGUUUCAGUGG | ||||
hsa-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU | ||||
hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU | ||||
hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU | ||||
hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG | ||||
hsa-miR-520a | AAAGUGCUUCCCUUUGGACUGU | ||||
hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG | ||||
hsa-miR-520c | AAAGUGCUUCCUUUUAGAGGGUU | ||||
hsa-miR-520d | AAAGUGCUUCUCUUUGGUGGGUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.