Gene Page: STMN3
Summary ?
GeneID | 50861 |
Symbol | STMN3 |
Synonyms | SCLIP |
Description | stathmin 3 |
Reference | MIM:608362|HGNC:HGNC:15926|Ensembl:ENSG00000197457|HPRD:16324|Vega:OTTHUMG00000032985 |
Gene type | protein-coding |
Map location | 20q13.3 |
Pascal p-value | 0.001 |
Sherlock p-value | 0.905 |
Fetal beta | -0.706 |
DMG | 1 (# studies) |
eGene | Cerebellar Hemisphere Cerebellum Cortex |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg04757428 | 20 | 62284615 | STMN3 | 1.529E-4 | -0.638 | 0.032 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0019904 | protein domain specific binding | ISS | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0031175 | neurite development | ISS | neuron, axon, neurite, dendrite (GO term level: 10) | - |
GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 9603203 |
GO:0007242 | intracellular signaling cascade | IEA | - | |
GO:0035021 | negative regulation of Rac protein signal transduction | ISS | - | |
GO:0032314 | regulation of Rac GTPase activity | ISS | - | |
GO:0031122 | cytoplasmic microtubule organization | ISS | - | |
GO:0051493 | regulation of cytoskeleton organization | ISS | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005737 | cytoplasm | ISS | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
BASAKI YBX1 TARGETS DN | 384 | 230 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 TARGETS DN | 260 | 143 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
SABATES COLORECTAL ADENOMA SIZE UP | 23 | 12 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2B | 392 | 251 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN | 164 | 111 | All SZGR 2.0 genes in this pathway |
STARK PREFRONTAL CORTEX 22Q11 DELETION DN | 517 | 309 | All SZGR 2.0 genes in this pathway |
NIKOLSKY BREAST CANCER 20Q12 Q13 AMPLICON | 149 | 76 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
MCCLUNG CREB1 TARGETS UP | 100 | 72 | All SZGR 2.0 genes in this pathway |
BILD MYC ONCOGENIC SIGNATURE | 206 | 117 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 | 528 | 324 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4 | 307 | 185 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY E2F4 UNSTIMULATED | 728 | 415 | All SZGR 2.0 genes in this pathway |
KONDO EZH2 TARGETS | 245 | 148 | All SZGR 2.0 genes in this pathway |
RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
STAMBOLSKY TARGETS OF MUTATED TP53 UP | 49 | 35 | All SZGR 2.0 genes in this pathway |
STAMBOLSKY RESPONSE TO VITAMIN D3 UP | 84 | 48 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS SENESCENT | 572 | 352 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS GROWING | 243 | 155 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
KOHOUTEK CCNT1 TARGETS | 50 | 26 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-151 | 72 | 78 | 1A | hsa-miR-151brain | ACUAGACUGAAGCUCCUUGAGG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.