SZGR2

Summary ?

GeneID	5179
Symbol	PENK
Synonyms	PE\|PENK-A
Description	proenkephalin
Reference	MIM:131330\|HGNC:HGNC:8831\|Ensembl:ENSG00000181195\|HPRD:08837\|Vega:OTTHUMG00000164409
Gene type	protein-coding
Map location	8q12.1
Pascal p-value	0.48
Fetal beta	0.619
eGene	Cerebellar Hemisphere Myers' cis & trans
Support	NEUROTROPHIN SIGNALING

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs10927978	chr1	14305081	PENK	5179	0.02	trans
rs17110698	chr1	55040550	PENK	5179	0	trans
rs596985	chr1	64277034	PENK	5179	0.12	trans
rs13447530	chr1	91983798	PENK	5179	4.564E-5	trans
rs16838771	chr1	157511227	PENK	5179	4.524E-7	trans
rs1028703	chr1	167270715	PENK	5179	0.01	trans
rs16823145	chr1	184397914	PENK	5179	0.15	trans
rs6713473	chr2	11284414	PENK	5179	0.01	trans
rs17019687	chr2	80972176	PENK	5179	0.07	trans
rs17028172	chr2	103608895	PENK	5179	0.08	trans
rs16829545	chr2	151977407	PENK	5179	0.08	trans
rs16841750	chr2	158288461	PENK	5179	0.12	trans
rs16839485	chr2	208117480	PENK	5179	0.1	trans
rs4378948		0	PENK	5179	0.17	trans
rs1344868	chr3	21311149	PENK	5179	0	trans
rs4627772		0	PENK	5179	0.01	trans
rs17079580	chr3	47363841	PENK	5179	0.01	trans
rs12629522	chr3	59430782	PENK	5179	0.12	trans
rs9879175	chr3	59992485	PENK	5179	0.05	trans
rs2120503	chr3	66779890	PENK	5179	0.12	trans
rs1587651	chr3	79944075	PENK	5179	0.02	trans
rs12637719	chr3	85328350	PENK	5179	0.14	trans
rs9310049	chr3	87236540	PENK	5179	0.03	trans
rs6807632	chr3	111395567	PENK	5179	0.03	trans
rs4689472	chr4	6533060	PENK	5179	0.02	trans
rs7654030	chr4	65592437	PENK	5179	0.19	trans
rs6821203	chr4	189475342	PENK	5179	0.05	trans
rs3111196	chr5	54402889	PENK	5179	0.16	trans
rs16894524	chr5	65192799	PENK	5179	1.872E-4	trans
rs17165234	chr5	126403634	PENK	5179	0.07	trans
rs1194997	chr5	146093747	PENK	5179	0.11	trans
rs6556379	chr5	158399386	PENK	5179	0.01	trans
rs17056426	chr5	158452806	PENK	5179	0.12	trans
rs16871026	chr6	32815487	PENK	5179	0.2	trans
rs794607	chr6	119274656	PENK	5179	0.02	trans
rs10499261	chr6	150283162	PENK	5179	0.07	trans
rs9397728	chr6	150514248	PENK	5179	0	trans
rs7841920	chr8	74581108	PENK	5179	0.09	trans
rs1892129	chr9	21055879	PENK	5179	0.11	trans
rs10968301	chr9	28043905	PENK	5179	0.03	trans
rs16910491	chr9	116673026	PENK	5179	8.564E-4	trans
snp_a-2108530		0	PENK	5179	0.01	trans
rs16922710	chr10	23087297	PENK	5179	0.13	trans
rs16922725	chr10	23100286	PENK	5179	0.17	trans
rs10508654	chr10	23104638	PENK	5179	0.05	trans
rs7081986	chr10	90807242	PENK	5179	0.13	trans
rs4980232	chr10	124577756	PENK	5179	0.03	trans
rs2019626	chr11	41926368	PENK	5179	0.12	trans
rs12580163	chr12	2134197	PENK	5179	0.08	trans
rs11178166	chr12	70670585	PENK	5179	0.18	trans
rs17054789	chr13	37561186	PENK	5179	0.11	trans
rs17054790	chr13	37562620	PENK	5179	0.11	trans
rs336224	chr13	110516305	PENK	5179	0.04	trans
rs17104965	chr14	37145915	PENK	5179	0.01	trans
rs8013398	chr14	61998391	PENK	5179	0.18	trans
rs16955618	chr15	29937543	PENK	5179	0.11	trans
rs2118961	chr15	40614199	PENK	5179	0.03	trans
rs587388	chr16	5518793	PENK	5179	0.12	trans
rs2919431	chr16	30709366	PENK	5179	0.04	trans
rs443222	chr16	83889679	PENK	5179	5.039E-4	trans
rs824575	chr16	83891459	PENK	5179	5.039E-4	trans
rs7210845	chr17	54122025	PENK	5179	2.143E-5	trans
rs12938916	chr17	55866286	PENK	5179	0.08	trans
rs755768	chr17	75023387	PENK	5179	0.09	trans
rs11081028	chr18	3269332	PENK	5179	0.05	trans
snp_a-2036900		0	PENK	5179	0	trans
rs9948702	chr18	34221076	PENK	5179	0.06	trans
rs17680225	chr18	34221269	PENK	5179	0.17	trans
rs8093472	chr18	74145030	PENK	5179	0.19	trans
rs1883720	chr20	12531179	PENK	5179	0.17	trans
rs2832308	chr21	30757493	PENK	5179	9.702E-4	trans
rs7277179	chr21	30758759	PENK	5179	0.03	trans
rs2835891	chr21	39056226	PENK	5179	0.07	trans
rs1894251	chr22	22440498	PENK	5179	0.13	trans
rs6519257	chr22	41889401	PENK	5179	0.01	trans
rs1883665	chrX	17650382	PENK	5179	0	trans
rs7062071	chrX	17724830	PENK	5179	0.02	trans
rs16989685	chrX	31527328	PENK	5179	0.11	trans
rs5972475	chrX	32032409	PENK	5179	1.02E-4	trans
rs17002014	chrX	138237892	PENK	5179	0.01	trans
rs7888371	chrX	138238854	PENK	5179	0.01	trans
rs7887301	chrX	138238881	PENK	5179	0.01	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
FZR1	0.86	0.89
CAPN1	0.86	0.89
UBA1	0.85	0.89
GRWD1	0.85	0.88
PYGB	0.85	0.86
TBCD	0.85	0.88
BBS1	0.85	0.87
SLC39A7	0.84	0.87
RAB11B	0.84	0.89
TELO2	0.84	0.87

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.31	-0.72	-0.78
MT-CO2	-0.69	-0.77
AF347015.33	-0.68	-0.75
AF347015.27	-0.67	-0.76
AF347015.21	-0.66	-0.78
C5orf53	-0.66	-0.68
MT-CYB	-0.65	-0.74
AF347015.8	-0.65	-0.75
IFI27	-0.65	-0.70
AC021016.1	-0.64	-0.71

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005184	neuropeptide hormone activity	TAS	axon, Synap, Brain, Neurotransmitter (GO term level: 6)	7057924
GO:0001515	opioid peptide activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007218	neuropeptide signaling pathway	IEA	Neurotransmitter (GO term level: 8)	-
GO:0001662	behavioral fear response	IEA		-
GO:0007165	signal transduction	TAS		7057924
GO:0007610	behavior	IEA		-
GO:0019233	sensory perception of pain	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005576	extracellular region	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID AP1 PATHWAY	70	60	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY GPCR	920	449	All SZGR 2.0 genes in this pathway
REACTOME PEPTIDE LIGAND BINDING RECEPTORS	188	108	All SZGR 2.0 genes in this pathway
REACTOME CLASS A1 RHODOPSIN LIKE RECEPTORS	305	177	All SZGR 2.0 genes in this pathway
REACTOME GPCR DOWNSTREAM SIGNALING	805	368	All SZGR 2.0 genes in this pathway
REACTOME G ALPHA I SIGNALLING EVENTS	195	114	All SZGR 2.0 genes in this pathway
REACTOME GPCR LIGAND BINDING	408	246	All SZGR 2.0 genes in this pathway
LIU PROSTATE CANCER DN	481	290	All SZGR 2.0 genes in this pathway
CORRE MULTIPLE MYELOMA DN	62	41	All SZGR 2.0 genes in this pathway
LANDIS BREAST CANCER PROGRESSION DN	70	43	All SZGR 2.0 genes in this pathway
CASTELLANO NRAS TARGETS UP	68	41	All SZGR 2.0 genes in this pathway
MARKEY RB1 ACUTE LOF DN	228	137	All SZGR 2.0 genes in this pathway
LANDIS ERBB2 BREAST TUMORS 65 DN	37	22	All SZGR 2.0 genes in this pathway
LANDIS ERBB2 BREAST PRENEOPLASTIC DN	55	33	All SZGR 2.0 genes in this pathway
LANDIS ERBB2 BREAST TUMORS 324 DN	149	93	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 5 6WK UP	116	68	All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP	584	356	All SZGR 2.0 genes in this pathway
HOWLIN PUBERTAL MAMMARY GLAND	69	40	All SZGR 2.0 genes in this pathway
HATADA METHYLATED IN LUNG CANCER UP	390	236	All SZGR 2.0 genes in this pathway
INGRAM SHH TARGETS UP	127	79	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 12HR UP	116	79	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP	487	286	All SZGR 2.0 genes in this pathway
RICKMAN HEAD AND NECK CANCER A	100	63	All SZGR 2.0 genes in this pathway
GOTZMANN EPITHELIAL TO MESENCHYMAL TRANSITION DN	206	136	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS	652	441	All SZGR 2.0 genes in this pathway
LEE TARGETS OF PTCH1 AND SUFU DN	83	69	All SZGR 2.0 genes in this pathway
ASTON MAJOR DEPRESSIVE DISORDER UP	49	36	All SZGR 2.0 genes in this pathway
KUMAR TARGETS OF MLL AF9 FUSION	405	264	All SZGR 2.0 genes in this pathway
TRAYNOR RETT SYNDROM UP	45	33	All SZGR 2.0 genes in this pathway
LU AGING BRAIN DN	153	120	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
MCCLUNG CREB1 TARGETS DN	57	39	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS UP	37	27	All SZGR 2.0 genes in this pathway
MCCLUNG COCAINE REWARD 5D	79	62	All SZGR 2.0 genes in this pathway
KAYO AGING MUSCLE UP	244	165	All SZGR 2.0 genes in this pathway
ZHU CMV ALL UP	120	89	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 UP	428	266	All SZGR 2.0 genes in this pathway
ZHU CMV 24 HR UP	93	65	All SZGR 2.0 genes in this pathway
LOPES METHYLATED IN COLON CANCER UP	27	20	All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER T4	94	69	All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER P4	100	62	All SZGR 2.0 genes in this pathway
BERNARD PPAPDC1B TARGETS UP	40	20	All SZGR 2.0 genes in this pathway
YAUCH HEDGEHOG SIGNALING PARACRINE UP	149	85	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
VALK AML CLUSTER 16	26	17	All SZGR 2.0 genes in this pathway
VALK AML WITH 11Q23 REARRANGED	22	13	All SZGR 2.0 genes in this pathway
YAGI AML WITH T 9 11 TRANSLOCATION	130	87	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3	349	234	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3	341	243	All SZGR 2.0 genes in this pathway
BILANGES SERUM SENSITIVE GENES	90	54	All SZGR 2.0 genes in this pathway
YANG BCL3 TARGETS UP	364	236	All SZGR 2.0 genes in this pathway
RATTENBACHER BOUND BY CELF1	467	251	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-200bc/429	185	192	1A,m8	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: PENK