SZGR2

Summary ?

GeneID	5245
Symbol	PHB
Synonyms	HEL-215\|HEL-S-54e\|PHB1
Description	prohibitin
Reference	MIM:176705\|HGNC:HGNC:8912\|Ensembl:ENSG00000167085\|HPRD:01454\|Vega:OTTHUMG00000134271
Gene type	protein-coding
Map location	17q21
Pascal p-value	0.37
Sherlock p-value	0.047
Fetal beta	-0.355
Support	INTRACELLULAR SIGNAL TRANSDUCTION G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS CompositeSet

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
STAG2	0.86	0.86
ZNF24	0.85	0.87
POLK	0.85	0.85
C1orf55	0.84	0.85
COPB2	0.84	0.83
KIAA1826	0.84	0.85
PICALM	0.84	0.87
EXOC5	0.84	0.84
CPSF2	0.83	0.84
SCARB2	0.83	0.87

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.21	-0.65	-0.72
IFI27	-0.64	-0.71
MT-CO2	-0.62	-0.68
FXYD1	-0.62	-0.68
AF347015.8	-0.60	-0.66
CXCL14	-0.60	-0.68
AF347015.31	-0.59	-0.66
AF347015.27	-0.59	-0.64
MYL3	-0.58	-0.63
AF347015.33	-0.58	-0.63

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IPI		11302691
GO:0016564	transcription repressor activity	IDA		12566959
GO:0016563	transcription activator activity	IDA		14500729
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006260	DNA replication	IEA		-
GO:0007165	signal transduction	TAS		16130169
GO:0008285	negative regulation of cell proliferation	NAS		12466959
GO:0042981	regulation of apoptosis	TAS		16130169
GO:0016481	negative regulation of transcription	IDA		12566959
GO:0016575	histone deacetylation	IDA		12466959
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	TAS		16130169
GO:0005654	nucleoplasm	IDA		12466959
GO:0005739	mitochondrion	IEA		-
GO:0005743	mitochondrial inner membrane	IEA		-
GO:0005743	mitochondrial inner membrane	TAS		14500729
GO:0016020	membrane	IEA		-
GO:0005887	integral to plasma membrane	IDA		15274632

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACTN1	FLJ40884	actinin, alpha 1	Affinity Capture-Western	BioGRID	12628297
ANXA2	ANX2 \| ANX2L4 \| CAL1H \| LIP2 \| LPC2 \| LPC2D \| P36 \| PAP-IV	annexin A2	-	HPRD,BioGRID	12628297
E2F1	E2F-1 \| RBAP1 \| RBBP3 \| RBP3	E2F transcription factor 1	Affinity Capture-Western Co-localization Reconstituted Complex	BioGRID	10523633 \|12065415 \|14500729 \|14637159
E2F1	E2F-1 \| RBAP1 \| RBBP3 \| RBP3	E2F transcription factor 1	-	HPRD	10523633 \|14637159
HDAC1	DKFZp686H12203 \| GON-10 \| HD1 \| RPD3 \| RPD3L1	histone deacetylase 1	-	HPRD,BioGRID	12466959
MAP3K10	MLK2 \| MST	mitogen-activated protein kinase kinase kinase 10	-	HPRD	9629920
NCOR1	KIAA1047 \| MGC104216 \| N-CoR \| TRAC1 \| hCIT529I10 \| hN-CoR	nuclear receptor co-repressor 1	-	HPRD,BioGRID	12466959
RAF1	CRAF \| NS5 \| Raf-1 \| c-Raf	v-raf-1 murine leukemia viral oncogene homolog 1	-	HPRD,BioGRID	10523633
RAF1	CRAF \| NS5 \| Raf-1 \| c-Raf	v-raf-1 murine leukemia viral oncogene homolog 1	RAF1 (c-Raf) interacts with PHB.	BIND	16041367
RB1	OSRC \| RB \| p105-Rb \| pRb \| pp110	retinoblastoma 1	-	HPRD,BioGRID	10376528
RBL1	CP107 \| MGC40006 \| PRB1 \| p107	retinoblastoma-like 1 (p107)	in vitro in vivo	BioGRID	10376528
RBL2	FLJ26459 \| P130 \| Rb2	retinoblastoma-like 2 (p130)	-	HPRD,BioGRID	10376528
SIN3A	DKFZp434K2235 \| FLJ90319 \| KIAA0700	SIN3 homolog A, transcription regulator (yeast)	Affinity Capture-Western	BioGRID	12466959
SMARCA2	BAF190 \| BRM \| FLJ36757 \| MGC74511 \| SNF2 \| SNF2L2 \| SNF2LA \| SWI2 \| Sth1p \| hBRM \| hSNF2a	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	Prohibitin interacts with Brm.	BIND	12065415
SMARCA2	BAF190 \| BRM \| FLJ36757 \| MGC74511 \| SNF2 \| SNF2L2 \| SNF2LA \| SWI2 \| Sth1p \| hBRM \| hSNF2a	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	-	HPRD,BioGRID	12065415
SMARCA4	BAF190 \| BRG1 \| FLJ39786 \| SNF2 \| SNF2-BETA \| SNF2L4 \| SNF2LB \| SWI2 \| hSNF2b	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	-	HPRD,BioGRID	12065415
SMARCA4	BAF190 \| BRG1 \| FLJ39786 \| SNF2 \| SNF2-BETA \| SNF2L4 \| SNF2LB \| SWI2 \| hSNF2b	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	Prohibitin interacts with Brg-1	BIND	12065415
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	Affinity Capture-Western Co-localization Reconstituted Complex	BioGRID	14500729

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP	285	181	All SZGR 2.0 genes in this pathway
GAZDA DIAMOND BLACKFAN ANEMIA MYELOID DN	38	25	All SZGR 2.0 genes in this pathway
GARY CD5 TARGETS DN	431	263	All SZGR 2.0 genes in this pathway
HORIUCHI WTAP TARGETS DN	310	188	All SZGR 2.0 genes in this pathway
UDAYAKUMAR MED1 TARGETS UP	135	82	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 24HR UP	557	331	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS UP	293	179	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN	485	334	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
HWANG PROSTATE CANCER MARKERS	28	19	All SZGR 2.0 genes in this pathway
LASTOWSKA NEUROBLASTOMA COPY NUMBER UP	181	108	All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER UP	358	245	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX	795	478	All SZGR 2.0 genes in this pathway
RICKMAN METASTASIS UP	344	180	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN	514	330	All SZGR 2.0 genes in this pathway
BENPORATH MYC TARGETS WITH EBOX	230	156	All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 17Q21 Q25 AMPLICON	335	181	All SZGR 2.0 genes in this pathway
MENSSEN MYC TARGETS	53	35	All SZGR 2.0 genes in this pathway
RADAEVA RESPONSE TO IFNA1 UP	52	40	All SZGR 2.0 genes in this pathway
MANALO HYPOXIA DN	289	166	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST DN	309	206	All SZGR 2.0 genes in this pathway
FERNANDEZ BOUND BY MYC	182	116	All SZGR 2.0 genes in this pathway
PENG GLUCOSE DEPRIVATION DN	169	112	All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN	546	351	All SZGR 2.0 genes in this pathway
PENG RAPAMYCIN RESPONSE DN	245	154	All SZGR 2.0 genes in this pathway
PENG GLUTAMINE DEPRIVATION DN	337	230	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA UP	64	46	All SZGR 2.0 genes in this pathway
WEIGEL OXIDATIVE STRESS BY HNE AND H2O2	39	29	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 5	126	78	All SZGR 2.0 genes in this pathway
YAMAZAKI TCEB3 TARGETS DN	215	132	All SZGR 2.0 genes in this pathway
LEE AGING NEOCORTEX UP	89	59	All SZGR 2.0 genes in this pathway
ZHOU TNF SIGNALING 30MIN	54	36	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 UP	428	266	All SZGR 2.0 genes in this pathway
TSENG IRS1 TARGETS UP	113	71	All SZGR 2.0 genes in this pathway
BILD MYC ONCOGENIC SIGNATURE	206	117	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN	911	527	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN	1011	592	All SZGR 2.0 genes in this pathway
STEIN ESRRA TARGETS RESPONSIVE TO ESTROGEN UP	31	20	All SZGR 2.0 genes in this pathway
MUELLER PLURINET	299	189	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN	366	257	All SZGR 2.0 genes in this pathway
AGUIRRE PANCREATIC CANCER COPY NUMBER UP	298	174	All SZGR 2.0 genes in this pathway
BOYAULT LIVER CANCER SUBCLASS G3 UP	188	121	All SZGR 2.0 genes in this pathway
STEIN ESRRA TARGETS	535	325	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA CLASSES UP	605	377	All SZGR 2.0 genes in this pathway
DANG MYC TARGETS UP	143	100	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
WONG EMBRYONIC STEM CELL CORE	335	193	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-128	92	99	1A,m8	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	92	99	1A,m8	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-205	768	774	1A	hsa-miR-205	UCCUUCAUUCCACCGGAGUCUG
miR-205	768	774	1A	hsa-miR-205	UCCUUCAUUCCACCGGAGUCUG
miR-27	93	100	1A,m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	93	100	1A,m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: PHB