Gene Page: PI4KB
Summary ?
GeneID | 5298 |
Symbol | PI4KB |
Synonyms | NPIK|PI4K-BETA|PI4K92|PI4KBETA|PI4KIIIBETA|PIK4CB |
Description | phosphatidylinositol 4-kinase beta |
Reference | MIM:602758|HGNC:HGNC:8984|Ensembl:ENSG00000143393|HPRD:11805|Vega:OTTHUMG00000012348 |
Gene type | protein-coding |
Map location | 1q21 |
Sherlock p-value | 0.873 |
DEG p-value | DEG:Maycox_2009:CC_BA10_fold_change=-1.16:CC_BA10_disease_P=0.0109:HBB_BA9_fold_change=-1.11:HBB_BA9_disease_P=0.0236 |
Fetal beta | -0.653 |
DMG | 1 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DEG:Maycox_2009 | Microarray to determine the expression of over 30000 mRNA transcripts in post-mortem tissue | We included 51 genes whose expression changes are common between two schizophrenia cohorts. | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg12936983 | 1 | 151299782 | PI4KB | 8.83E-9 | -0.012 | 4.06E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MPPE1 | 0.72 | 0.66 |
AC009041.3 | 0.71 | 0.64 |
C8orf47 | 0.71 | 0.52 |
TDRD5 | 0.71 | 0.68 |
C8orf85 | 0.70 | 0.61 |
CHRM4 | 0.70 | 0.58 |
FHOD1 | 0.70 | 0.52 |
AC009041.1 | 0.70 | 0.61 |
TTC22 | 0.69 | 0.51 |
AP000911.1 | 0.68 | 0.39 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.21 | -0.38 | -0.32 |
AF347015.2 | -0.36 | -0.30 |
AF347015.31 | -0.36 | -0.32 |
MT-CO2 | -0.35 | -0.31 |
AF347015.8 | -0.34 | -0.30 |
AF347015.18 | -0.33 | -0.27 |
AF347015.15 | -0.33 | -0.29 |
MT-CYB | -0.32 | -0.30 |
MT-ATP8 | -0.32 | -0.31 |
AF347015.27 | -0.31 | -0.31 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IPI | 17353931 | |
GO:0004428 | inositol or phosphatidylinositol kinase activity | IEA | - | |
GO:0004430 | 1-phosphatidylinositol 4-kinase activity | TAS | 9584208 | |
GO:0016773 | phosphotransferase activity, alcohol group as acceptor | IEA | - | |
GO:0016740 | transferase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006661 | phosphatidylinositol biosynthetic process | TAS | 9020160 | |
GO:0007165 | signal transduction | TAS | 9020160 | |
GO:0048015 | phosphoinositide-mediated signaling | IEA | - | |
GO:0006898 | receptor-mediated endocytosis | TAS | 9584208 | |
GO:0046854 | phosphoinositide phosphorylation | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0012505 | endomembrane system | IEA | - | |
GO:0005794 | Golgi apparatus | IEA | - | |
GO:0005737 | cytoplasm | TAS | 9584208 | |
GO:0005739 | mitochondrion | IEA | - | |
GO:0005741 | mitochondrial outer membrane | IEA | - | |
GO:0005768 | endosome | TAS | 9584208 | |
GO:0005783 | endoplasmic reticulum | IEA | - | |
GO:0016020 | membrane | IEA | - | |
GO:0030867 | rough endoplasmic reticulum membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG INOSITOL PHOSPHATE METABOLISM | 54 | 42 | All SZGR 2.0 genes in this pathway |
KEGG PHOSPHATIDYLINOSITOL SIGNALING SYSTEM | 76 | 56 | All SZGR 2.0 genes in this pathway |
PID AVB3 INTEGRIN PATHWAY | 75 | 53 | All SZGR 2.0 genes in this pathway |
REACTOME SYNTHESIS OF PIPS AT THE GOLGI MEMBRANE | 17 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME PHOSPHOLIPID METABOLISM | 198 | 112 | All SZGR 2.0 genes in this pathway |
REACTOME PI METABOLISM | 48 | 34 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF LIPIDS AND LIPOPROTEINS | 478 | 302 | All SZGR 2.0 genes in this pathway |
GARY CD5 TARGETS UP | 473 | 314 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP | 276 | 165 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 SIGNATURE 3 UP | 341 | 197 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS DN | 459 | 276 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 3 DN | 229 | 142 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE UP | 134 | 93 | All SZGR 2.0 genes in this pathway |
LOCKWOOD AMPLIFIED IN LUNG CANCER | 214 | 139 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP | 390 | 242 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN | 287 | 208 | All SZGR 2.0 genes in this pathway |
LIN MELANOMA COPY NUMBER UP | 73 | 53 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR UP | 294 | 199 | All SZGR 2.0 genes in this pathway |
BREDEMEYER RAG SIGNALING NOT VIA ATM UP | 62 | 29 | All SZGR 2.0 genes in this pathway |
GU PDEF TARGETS DN | 39 | 20 | All SZGR 2.0 genes in this pathway |
HOFFMANN PRE BI TO LARGE PRE BII LYMPHOCYTE UP | 36 | 24 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA CHEMOTAXIS DN | 457 | 302 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH INV 16 TRANSLOCATION | 422 | 277 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-103/107 | 443 | 449 | m8 | hsa-miR-103brain | AGCAGCAUUGUACAGGGCUAUGA |
hsa-miR-107brain | AGCAGCAUUGUACAGGGCUAUCA | ||||
miR-15/16/195/424/497 | 444 | 450 | m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.