Gene Page: PPP2R2A
Summary ?
| GeneID | 5520 |
| Symbol | PPP2R2A |
| Synonyms | B55A|B55ALPHA|PR52A|PR55A |
| Description | protein phosphatase 2 regulatory subunit B, alpha |
| Reference | MIM:604941|HGNC:HGNC:9304|Ensembl:ENSG00000221914|HPRD:09223|Vega:OTTHUMG00000163850 |
| Gene type | protein-coding |
| Map location | 8p21.2 |
| Pascal p-value | 0.019 |
| Sherlock p-value | 1.526E-4 |
| Fetal beta | -0.37 |
| DMG | 1 (# studies) |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| GSMA_I | Genome scan meta-analysis | Psr: 0.031 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.03086 | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.00057 | |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.098 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg08317834 | 8 | 26148868 | PPP2R2A | 1.47E-5 | -0.251 | 0.015 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| C13orf15 | 0.80 | 0.81 |
| CEBPD | 0.79 | 0.79 |
| SAT1 | 0.76 | 0.75 |
| TM4SF1 | 0.76 | 0.78 |
| MT2A | 0.76 | 0.77 |
| ACSL5 | 0.74 | 0.79 |
| IFITM2 | 0.73 | 0.74 |
| PLSCR1 | 0.73 | 0.72 |
| GIMAP5 | 0.73 | 0.80 |
| C10orf54 | 0.72 | 0.76 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| SAFB | -0.68 | -0.77 |
| AGPAT6 | -0.67 | -0.75 |
| UBTF | -0.67 | -0.77 |
| RNF40 | -0.67 | -0.75 |
| GPATCH1 | -0.67 | -0.75 |
| LSM14B | -0.66 | -0.74 |
| NEURL4 | -0.66 | -0.74 |
| SFRS14 | -0.66 | -0.73 |
| GTF2F1 | -0.66 | -0.74 |
| PDCD11 | -0.66 | -0.75 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IPI | 9847399 | |
| GO:0004722 | protein serine/threonine phosphatase activity | IDA | 1849734 | |
| GO:0008601 | protein phosphatase type 2A regulator activity | IEA | - | |
| GO:0008601 | protein phosphatase type 2A regulator activity | TAS | 1849734 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006470 | protein amino acid dephosphorylation | IDA | 1849734 | |
| GO:0007165 | signal transduction | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000159 | protein phosphatase type 2A complex | IDA | 1849734 | |
| GO:0000159 | protein phosphatase type 2A complex | IEA | - |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| ATR | FRP1 | MEC1 | SCKL | SCKL1 | ataxia telangiectasia and Rad3 related | Protein-peptide | BioGRID | 10608806 |
| EIF4EBP1 | 4E-BP1 | 4EBP1 | BP-1 | MGC4316 | PHAS-I | eukaryotic translation initiation factor 4E binding protein 1 | Affinity Capture-Western | BioGRID | 16899564 |
| FAM107A | DRR1 | FLJ30158 | FLJ45473 | TU3A | family with sequence similarity 107, member A | Affinity Capture-MS | BioGRID | 17353931 |
| FRAP1 | FLJ44809 | FRAP | FRAP2 | MTOR | RAFT1 | RAPT1 | FK506 binding protein 12-rapamycin associated protein 1 | Reconstituted Complex | BioGRID | 10200280 |
| GRIN1 | NMDA1 | NMDAR1 | NR1 | glutamate receptor, ionotropic, N-methyl D-aspartate 1 | - | HPRD | 10862698 |
| PPP2CA | PP2Ac | PP2CA | RP-C | protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform | - | HPRD,BioGRID | 1328247 |
| PPP2CB | PP2CB | protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform | Affinity Capture-MS | BioGRID | 18782753 |
| PPP2R1A | MGC786 | PR65A | protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform | Affinity Capture-MS Affinity Capture-Western Reconstituted Complex | BioGRID | 12370081 |18782753 |
| PPP2R1B | MGC26454 | PR65B | protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform | - | HPRD,BioGRID | 1328247 |
| RAF1 | CRAF | NS5 | Raf-1 | c-Raf | v-raf-1 murine leukemia viral oncogene homolog 1 | RAF1 (c-Raf) interact with an unspecified isoform of PPP2R2A (PP2A-A). | BIND | 16041367 |
| RPS6KB1 | PS6K | S6K | S6K1 | STK14A | p70(S6K)-alpha | p70-S6K | p70-alpha | ribosomal protein S6 kinase, 70kDa, polypeptide 1 | Affinity Capture-Western | BioGRID | 10200280 |16899564 |
| RRN3 | DKFZp566E104 | MGC104238 | TIFIA | RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae) | Reconstituted Complex | BioGRID | 15004009 |
| STRN3 | SG2NA | striatin, calmodulin binding protein 3 | - | HPRD | 10681496 |
| TCEAL1 | SIIR | p21 | pp21 | transcription elongation factor A (SII)-like 1 | Affinity Capture-MS | BioGRID | 17353931 |
| TGFBR1 | AAT5 | ACVRLK4 | ALK-5 | ALK5 | LDS1A | LDS2A | SKR4 | TGFR-1 | transforming growth factor, beta receptor 1 | Affinity Capture-Western Reconstituted Complex | BioGRID | 9774674 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG TIGHT JUNCTION | 134 | 86 | All SZGR 2.0 genes in this pathway |
| BIOCARTA CHREBP2 PATHWAY | 42 | 35 | All SZGR 2.0 genes in this pathway |
| PID ERBB1 DOWNSTREAM PATHWAY | 105 | 78 | All SZGR 2.0 genes in this pathway |
| PID TGFBR PATHWAY | 55 | 38 | All SZGR 2.0 genes in this pathway |
| REACTOME CELL CYCLE | 421 | 253 | All SZGR 2.0 genes in this pathway |
| REACTOME CELL CYCLE MITOTIC | 325 | 185 | All SZGR 2.0 genes in this pathway |
| REACTOME G1 PHASE | 38 | 23 | All SZGR 2.0 genes in this pathway |
| REACTOME METABOLISM OF MRNA | 284 | 128 | All SZGR 2.0 genes in this pathway |
| REACTOME METABOLISM OF RNA | 330 | 155 | All SZGR 2.0 genes in this pathway |
| REACTOME MITOTIC G1 G1 S PHASES | 137 | 79 | All SZGR 2.0 genes in this pathway |
| REACTOME NONSENSE MEDIATED DECAY ENHANCED BY THE EXON JUNCTION COMPLEX | 176 | 57 | All SZGR 2.0 genes in this pathway |
| HOLLMANN APOPTOSIS VIA CD40 UP | 201 | 125 | All SZGR 2.0 genes in this pathway |
| LIU SOX4 TARGETS DN | 309 | 191 | All SZGR 2.0 genes in this pathway |
| KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
| CHOI ATL STAGE PREDICTOR | 44 | 24 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
| SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
| MANTOVANI VIRAL GPCR SIGNALING UP | 86 | 54 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
| SMITH TERT TARGETS UP | 145 | 91 | All SZGR 2.0 genes in this pathway |
| BECKER TAMOXIFEN RESISTANCE UP | 50 | 36 | All SZGR 2.0 genes in this pathway |
| KUROKAWA LIVER CANCER CHEMOTHERAPY DN | 41 | 28 | All SZGR 2.0 genes in this pathway |
| PENG RAPAMYCIN RESPONSE DN | 245 | 154 | All SZGR 2.0 genes in this pathway |
| PENG GLUTAMINE DEPRIVATION DN | 337 | 230 | All SZGR 2.0 genes in this pathway |
| LI WILMS TUMOR VS FETAL KIDNEY 1 DN | 163 | 115 | All SZGR 2.0 genes in this pathway |
| FERRANDO T ALL WITH MLL ENL FUSION DN | 87 | 57 | All SZGR 2.0 genes in this pathway |
| THEILGAARD NEUTROPHIL AT SKIN WOUND UP | 77 | 52 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 14HR UP | 156 | 101 | All SZGR 2.0 genes in this pathway |
| SESTO RESPONSE TO UV C1 | 72 | 45 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
| DAIRKEE CANCER PRONE RESPONSE BPA E2 | 118 | 65 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER CANCER DN | 540 | 340 | All SZGR 2.0 genes in this pathway |
| ACEVEDO METHYLATED IN LIVER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
| YAGI AML WITH INV 16 TRANSLOCATION | 422 | 277 | All SZGR 2.0 genes in this pathway |
| FOURNIER ACINAR DEVELOPMENT LATE 2 | 277 | 172 | All SZGR 2.0 genes in this pathway |
| WHITFIELD CELL CYCLE M G1 | 148 | 95 | All SZGR 2.0 genes in this pathway |
| KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
| LU EZH2 TARGETS UP | 295 | 155 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D | 882 | 506 | All SZGR 2.0 genes in this pathway |
| VANOEVELEN MYOGENESIS SIN3A TARGETS | 220 | 133 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-101 | 380 | 386 | 1A | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
| miR-136 | 149 | 155 | 1A | hsa-miR-136 | ACUCCAUUUGUUUUGAUGAUGGA |
| miR-141/200a | 104 | 110 | m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
| hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
| miR-144 | 380 | 386 | 1A | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
| miR-17-5p/20/93.mr/106/519.d | 219 | 225 | m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
| hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
| hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
| hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
| hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
| hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
| miR-183 | 118 | 124 | m8 | hsa-miR-183 | UAUGGCACUGGUAGAAUUCACUG |
| miR-218 | 558 | 564 | m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
| miR-221/222 | 452 | 458 | 1A | hsa-miR-221brain | AGCUACAUUGUCUGCUGGGUUUC |
| hsa-miR-222brain | AGCUACAUCUGGCUACUGGGUCUC | ||||
| miR-31 | 250 | 256 | m8 | hsa-miR-31 | AGGCAAGAUGCUGGCAUAGCUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.