Gene Page: MASP1
Summary ?
GeneID | 5648 |
Symbol | MASP1 |
Synonyms | 3MC1|CRARF|CRARF1|MAP1|MASP|MASP3|MAp44|PRSS5|RaRF |
Description | mannan binding lectin serine peptidase 1 |
Reference | MIM:600521|HGNC:HGNC:6901|Ensembl:ENSG00000127241|HPRD:02749|Vega:OTTHUMG00000156461 |
Gene type | protein-coding |
Map location | 3q27-q28 |
Pascal p-value | 0.049 |
Sherlock p-value | 0.869 |
Fetal beta | 0.191 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004252 | serine-type endopeptidase activity | IEA | glutamate (GO term level: 7) | - |
GO:0004252 | serine-type endopeptidase activity | TAS | glutamate (GO term level: 7) | 8018603 |
GO:0003824 | catalytic activity | IEA | - | |
GO:0005529 | sugar binding | IEA | - | |
GO:0005509 | calcium ion binding | IEA | - | |
GO:0008233 | peptidase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0001867 | complement activation, lectin pathway | EXP | 11532276 | |
GO:0006508 | proteolysis | IEA | - | |
GO:0006958 | complement activation, classical pathway | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005576 | extracellular region | EXP | 10639434 |10925294 | |
GO:0043231 | intracellular membrane-bounded organelle | IDA | 18029348 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG COMPLEMENT AND COAGULATION CASCADES | 69 | 49 | All SZGR 2.0 genes in this pathway |
BIOCARTA COMP PATHWAY | 19 | 15 | All SZGR 2.0 genes in this pathway |
BIOCARTA LECTIN PATHWAY | 12 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME INNATE IMMUNE SYSTEM | 279 | 178 | All SZGR 2.0 genes in this pathway |
REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
REACTOME COMPLEMENT CASCADE | 32 | 22 | All SZGR 2.0 genes in this pathway |
REACTOME CREATION OF C4 AND C2 ACTIVATORS | 10 | 5 | All SZGR 2.0 genes in this pathway |
REACTOME INITIAL TRIGGERING OF COMPLEMENT | 16 | 10 | All SZGR 2.0 genes in this pathway |
LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA DN | 526 | 357 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION DN | 234 | 147 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP | 612 | 367 | All SZGR 2.0 genes in this pathway |
WONG ENDMETRIUM CANCER DN | 82 | 53 | All SZGR 2.0 genes in this pathway |
SHETH LIVER CANCER VS TXNIP LOSS PAM4 | 261 | 153 | All SZGR 2.0 genes in this pathway |
WOTTON RUNX TARGETS UP | 21 | 14 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP | 487 | 286 | All SZGR 2.0 genes in this pathway |
LEE TARGETS OF PTCH1 AND SUFU DN | 83 | 69 | All SZGR 2.0 genes in this pathway |
LEE LIVER CANCER ACOX1 DN | 65 | 39 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA UP | 64 | 46 | All SZGR 2.0 genes in this pathway |
URS ADIPOCYTE DIFFERENTIATION UP | 74 | 51 | All SZGR 2.0 genes in this pathway |
LEE AGING NEOCORTEX DN | 80 | 49 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 48HR DN | 504 | 323 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
LABBE TGFB1 TARGETS DN | 108 | 64 | All SZGR 2.0 genes in this pathway |
YAUCH HEDGEHOG SIGNALING PARACRINE UP | 149 | 85 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
BOYAULT LIVER CANCER SUBCLASS G3 DN | 51 | 32 | All SZGR 2.0 genes in this pathway |
YAMASHITA LIVER CANCER STEM CELL DN | 76 | 51 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF LCP WITH H3K4ME3 | 128 | 68 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC LCP WITH H3K4ME3 | 58 | 34 | All SZGR 2.0 genes in this pathway |
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 DN | 157 | 106 | All SZGR 2.0 genes in this pathway |
OHGUCHI LIVER HNF4A TARGETS DN | 149 | 85 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
CHANGOLKAR H2AFY TARGETS DN | 40 | 26 | All SZGR 2.0 genes in this pathway |
YANG BCL3 TARGETS UP | 364 | 236 | All SZGR 2.0 genes in this pathway |
NABA ECM REGULATORS | 238 | 125 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME ASSOCIATED | 753 | 411 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 304 | 310 | m8 | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-125/351 | 1501 | 1508 | 1A,m8 | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.