SZGR2

Summary ?

GeneID	56998
Symbol	CTNNBIP1
Synonyms	ICAT
Description	catenin beta interacting protein 1
Reference	MIM:607758\|HGNC:HGNC:16913\|Ensembl:ENSG00000178585\|HPRD:09677\|Vega:OTTHUMG00000001796
Gene type	protein-coding
Map location	1p36.22
Pascal p-value	0.613
Sherlock p-value	0.126
Fetal beta	0.35
DMG	1 (# studies)
eGene	Cerebellar Hemisphere Frontal Cortex BA9

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0069

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg21604136	1	9910137	CTNNBIP1	1.979E-4	0.358	0.035	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008013	beta-catenin binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000122	negative regulation of transcription from RNA polymerase II promoter	IEA		-
GO:0006355	regulation of transcription, DNA-dependent	TAS		10898789
GO:0009952	anterior/posterior pattern formation	IEA		-
GO:0007165	signal transduction	TAS		10898789
GO:0008283	cell proliferation	TAS		10898789
GO:0007275	multicellular organismal development	TAS		10898789
GO:0030178	negative regulation of Wnt receptor signaling pathway	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0005737	cytoplasm	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
BEND5	C1orf165 \| FLJ11588	BEN domain containing 5	Two-hybrid	BioGRID	16189514
CASP4	ICE(rel)II \| ICEREL-II \| ICH-2 \| Mih1/TX \| TX	caspase 4, apoptosis-related cysteine peptidase	Affinity Capture-MS	BioGRID	17353931
CPVL	HVLP \| MGC10029	carboxypeptidase, vitellogenic-like	Affinity Capture-MS	BioGRID	17353931
CTNNB1	CTNNB \| DKFZp686D02253 \| FLJ25606 \| FLJ37923	catenin (cadherin-associated protein), beta 1, 88kDa	-	HPRD,BioGRID	10898789
CTSA	GLB2 \| GSL \| NGBE \| PPCA \| PPGB	cathepsin A	Affinity Capture-MS	BioGRID	17353931
GLB1	EBP \| ELNR1	galactosidase, beta 1	Affinity Capture-MS	BioGRID	17353931
GOT2	FLJ40994 \| KAT4 \| KATIV \| mitAAT	glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2)	Affinity Capture-MS	BioGRID	17353931
JUP	ARVD12 \| CTNNG \| DP3 \| DPIII \| PDGB \| PKGB	junction plakoglobin	Affinity Capture-MS Two-hybrid	BioGRID	16189514 \|17353931
NACAP1	FKSG17	nascent-polypeptide-associated complex alpha polypeptide pseudogene 1	Affinity Capture-MS	BioGRID	17353931
PNMA2	KIAA0883 \| MA2 \| MM2 \| RGAG2	paraneoplastic antigen MA2	Affinity Capture-MS	BioGRID	17353931
PPP2R1A	MGC786 \| PR65A	protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform	Affinity Capture-MS	BioGRID	17353931
RPA3	REPA3	replication protein A3, 14kDa	Affinity Capture-MS	BioGRID	17353931

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG WNT SIGNALING PATHWAY	151	112	All SZGR 2.0 genes in this pathway
WNT SIGNALING	89	71	All SZGR 2.0 genes in this pathway
PID BETA CATENIN NUC PATHWAY	80	60	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA DN	526	357	All SZGR 2.0 genes in this pathway
JAEGER METASTASIS DN	258	141	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN	508	354	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN	800	473	All SZGR 2.0 genes in this pathway
WANG RESPONSE TO BEXAROTENE UP	34	17	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN	637	377	All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215	893	528	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN	434	302	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN	543	317	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
ZHENG GLIOBLASTOMA PLASTICITY UP	250	168	All SZGR 2.0 genes in this pathway
BOCHKIS FOXA2 TARGETS	425	261	All SZGR 2.0 genes in this pathway
WINNEPENNINCKX MELANOMA METASTASIS DN	46	26	All SZGR 2.0 genes in this pathway
KARLSSON TGFB1 TARGETS DN	207	139	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-10	511	517	m8	hsa-miR-10a	UACCCUGUAGAUCCGAAUUUGUG
miR-10	511	517	m8	hsa-miR-10b	UACCCUGUAGAACCGAAUUUGU
miR-145	407	414	1A,m8	hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCUU
miR-192/215	362	368	m8	hsa-miR-192	CUGACCUAUGAAUUGACAGCC
miR-192/215	362	368	m8	hsa-miR-215	AUGACCUAUGAAUUGACAGAC
miR-23	379	386	1A,m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	379	386	1A,m8	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-25/32/92/363/367	571	577	1A	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-26	542	548	1A	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	542	548	1A	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-29	350	356	m8	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-323	379	385	1A	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CTNNBIP1