Gene Page: QARS
Summary ?
GeneID | 5859 |
Symbol | QARS |
Synonyms | GLNRS|MSCCA|PRO2195 |
Description | glutaminyl-tRNA synthetase |
Reference | MIM:603727|HGNC:HGNC:9751|Ensembl:ENSG00000172053|HPRD:07223|Vega:OTTHUMG00000156774 |
Gene type | protein-coding |
Map location | 3p21.31 |
Pascal p-value | 0.025 |
Sherlock p-value | 0.187 |
Fetal beta | 0.649 |
DMG | 1 (# studies) |
Support | Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg09092311 | 3 | 49142581 | QARS | 6.3E-8 | -0.011 | 1.57E-5 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
METTL3 | 0.85 | 0.86 |
TEKT2 | 0.83 | 0.80 |
RBM5 | 0.82 | 0.83 |
WDR19 | 0.82 | 0.84 |
C20orf96 | 0.82 | 0.89 |
CENPT | 0.82 | 0.84 |
EXOSC10 | 0.81 | 0.87 |
ZNF789 | 0.81 | 0.80 |
C3orf62 | 0.81 | 0.77 |
TCTN2 | 0.80 | 0.83 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.27 | -0.64 | -0.78 |
AF347015.31 | -0.63 | -0.77 |
MT-CO2 | -0.62 | -0.76 |
MT-CYB | -0.60 | -0.75 |
AF347015.8 | -0.60 | -0.75 |
AF347015.33 | -0.60 | -0.72 |
HLA-F | -0.60 | -0.65 |
ABCG2 | -0.58 | -0.67 |
AF347015.15 | -0.58 | -0.73 |
COPZ2 | -0.57 | -0.67 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0004819 | glutamine-tRNA ligase activity | IEA | - | |
GO:0004819 | glutamine-tRNA ligase activity | TAS | 8078941 | |
GO:0005515 | protein binding | IPI | 14667819 | |
GO:0005524 | ATP binding | IEA | - | |
GO:0016874 | ligase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006424 | glutamyl-tRNA aminoacylation | IEA | glutamate (GO term level: 11) | - |
GO:0006425 | glutaminyl-tRNA aminoacylation | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG AMINOACYL TRNA BIOSYNTHESIS | 41 | 33 | All SZGR 2.0 genes in this pathway |
REACTOME MITOCHONDRIAL TRNA AMINOACYLATION | 21 | 17 | All SZGR 2.0 genes in this pathway |
REACTOME CYTOSOLIC TRNA AMINOACYLATION | 24 | 19 | All SZGR 2.0 genes in this pathway |
REACTOME TRNA AMINOACYLATION | 42 | 34 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA DN | 526 | 357 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 MUTATED SIGNATURE 1 DN | 126 | 86 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 MUTATED SIGNATURE 2 DN | 77 | 46 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 SIGNATURE 3 DN | 162 | 116 | All SZGR 2.0 genes in this pathway |
OUELLET CULTURED OVARIAN CANCER INVASIVE VS LMP UP | 69 | 40 | All SZGR 2.0 genes in this pathway |
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
DAIRKEE TERT TARGETS UP | 380 | 213 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
SHEPARD CRUSH AND BURN MUTANT UP | 197 | 110 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP | 390 | 242 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
KAYO AGING MUSCLE DN | 123 | 76 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS INTERMEDIATE PROGENITOR | 149 | 84 | All SZGR 2.0 genes in this pathway |
GAVIN FOXP3 TARGETS CLUSTER T7 | 98 | 63 | All SZGR 2.0 genes in this pathway |
STEIN ESRRA TARGETS UP | 388 | 234 | All SZGR 2.0 genes in this pathway |
RIZKI TUMOR INVASIVENESS 3D DN | 270 | 181 | All SZGR 2.0 genes in this pathway |
ACEVEDO NORMAL TISSUE ADJACENT TO LIVER TUMOR DN | 354 | 216 | All SZGR 2.0 genes in this pathway |
CHNG MULTIPLE MYELOMA HYPERPLOID UP | 52 | 25 | All SZGR 2.0 genes in this pathway |
HSIAO HOUSEKEEPING GENES | 389 | 245 | All SZGR 2.0 genes in this pathway |
ZHAN VARIABLE EARLY DIFFERENTIATION GENES DN | 30 | 19 | All SZGR 2.0 genes in this pathway |
ROME INSULIN TARGETS IN MUSCLE UP | 442 | 263 | All SZGR 2.0 genes in this pathway |
STEIN ESRRA TARGETS | 535 | 325 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA CLASSES UP | 605 | 377 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 12 | 79 | 54 | All SZGR 2.0 genes in this pathway |
BILANGES SERUM AND RAPAMYCIN SENSITIVE GENES | 68 | 35 | All SZGR 2.0 genes in this pathway |
FOSTER KDM1A TARGETS DN | 211 | 119 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY STEM CELL DN | 428 | 246 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 17 | 24 | 1A,m8 | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.