Gene Page: RAB5A
Summary ?
| GeneID | 5868 |
| Symbol | RAB5A |
| Synonyms | RAB5 |
| Description | RAB5A, member RAS oncogene family |
| Reference | MIM:179512|HGNC:HGNC:9783|Ensembl:ENSG00000144566|HPRD:01542|Vega:OTTHUMG00000129889 |
| Gene type | protein-coding |
| Map location | 3p24.3 |
| Pascal p-value | 0.027 |
| Sherlock p-value | 0.248 |
| Support | INTRACELLULAR TRAFFICKING G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.humanPSD G2Cdb.humanPSP |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.006 | |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.012 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MAST2 | 0.95 | 0.93 |
| ANKRD13B | 0.93 | 0.94 |
| ZNF446 | 0.93 | 0.94 |
| AC145098.2 | 0.93 | 0.93 |
| KIAA1602 | 0.93 | 0.93 |
| SMPD4 | 0.93 | 0.95 |
| GPR173 | 0.93 | 0.92 |
| CCDC120 | 0.92 | 0.91 |
| PPRC1 | 0.92 | 0.92 |
| KIAA0895L | 0.92 | 0.93 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.31 | -0.72 | -0.83 |
| AF347015.27 | -0.71 | -0.82 |
| C5orf53 | -0.70 | -0.73 |
| MT-CO2 | -0.69 | -0.82 |
| COPZ2 | -0.67 | -0.75 |
| AF347015.33 | -0.67 | -0.77 |
| AF347015.8 | -0.66 | -0.81 |
| IFI27 | -0.66 | -0.75 |
| MT-CYB | -0.66 | -0.78 |
| S100B | -0.66 | -0.74 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0003924 | GTPase activity | TAS | 2501306 | |
| GO:0005515 | protein binding | IPI | 9697774 |15016378 | |
| GO:0005515 | protein binding | NAS | 14613930 | |
| GO:0005525 | GTP binding | IEA | - | |
| GO:0019001 | guanyl nucleotide binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007264 | small GTPase mediated signal transduction | IEA | - | |
| GO:0006897 | endocytosis | TAS | 8521472 | |
| GO:0015031 | protein transport | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0001726 | ruffle | IEA | - | |
| GO:0005886 | plasma membrane | IEA | - | |
| GO:0030139 | endocytic vesicle | IEA | - | |
| GO:0042470 | melanosome | IEA | - | |
| GO:0031901 | early endosome membrane | IEA | - | |
| GO:0045121 | membrane raft | IEA | - |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| AGTR1 | AG2S | AGTR1A | AGTR1B | AT1 | AT1B | AT1R | AT2R1 | AT2R1A | AT2R1B | HAT1R | angiotensin II receptor, type 1 | - | HPRD,BioGRID | 11682489 |
| ALS2CL | DKFZp686P238 | MGC129698 | RN49018 | ALS2 C-terminal like | - | HPRD,BioGRID | 15388334 |
| AP1G1 | ADTG | CLAPG1 | MGC18255 | adaptor-related protein complex 1, gamma 1 subunit | Two-hybrid | BioGRID | 14665628 |
| AP1G2 | G2AD | adaptor-related protein complex 1, gamma 2 subunit | Two-hybrid | BioGRID | 14665628 |
| CHM | DXS540 | FLJ38564 | GGTA | HSD-32 | MGC102710 | REP-1 | TCD | choroideremia (Rab escort protein 1) | Reconstituted Complex | BioGRID | 8294464 |
| CHML | FLJ10071 | FLJ13361 | REP2 | choroideremia-like (Rab escort protein 2) | - | HPRD,BioGRID | 8294464 |9730828 |
| EEA1 | MST105 | MSTP105 | ZFYVE2 | early endosome antigen 1 | Rab5 interacts with EEA.1. | BIND | 15782196 |
| EEA1 | MST105 | MSTP105 | ZFYVE2 | early endosome antigen 1 | - | HPRD | 10491193 |14600265 |
| EEA1 | MST105 | MSTP105 | ZFYVE2 | early endosome antigen 1 | FRET Reconstituted Complex Two-hybrid | BioGRID | 11493665 |11718716 |14600265 |
| GDI2 | FLJ16452 | FLJ37352 | RABGDIB | GDP dissociation inhibitor 2 | - | HPRD,BioGRID | 10512627 |
| GGA1 | - | golgi associated, gamma adaptin ear containing, ARF binding protein 1 | Two-hybrid | BioGRID | 14665628 |
| GGA2 | FLJ20966 | KIAA1080 | VEAR | golgi associated, gamma adaptin ear containing, ARF binding protein 2 | Two-hybrid | BioGRID | 14665628 |
| GGA3 | KIAA0154 | golgi associated, gamma adaptin ear containing, ARF binding protein 3 | Two-hybrid | BioGRID | 14665628 |
| KIF3B | HH0048 | KIAA0359 | kinesin family member 3B | Affinity Capture-Western | BioGRID | 12832475 |
| RAB37 | FLJ30284 | FLJ32507 | RAB37, member RAS oncogene family | - | HPRD,BioGRID | 10722846 |
| RAB4A | HRES-1/RAB4 | RAB4 | RAB4A, member RAS oncogene family | Co-purification | BioGRID | 9524117 |
| RAB5A | RAB5 | RAB5A, member RAS oncogene family | Rab5 interacts with a second Rab5 molecule. | BIND | 15782196 |
| RAB7A | FLJ20819 | PRO2706 | RAB7 | RAB7A, member RAS oncogene family | Two-hybrid | BioGRID | 10329441 |
| RABAC1 | PRA1 | PRAF1 | YIP3 | Rab acceptor 1 (prenylated) | - | HPRD | 10329441 |
| RABEP1 | RAB5EP | RABPT5 | rabaptin, RAB GTPase binding effector protein 1 | Co-purification Reconstituted Complex Two-hybrid | BioGRID | 8521472 |9045618 |9524117 |11718716 |
| RABEP1 | RAB5EP | RABPT5 | rabaptin, RAB GTPase binding effector protein 1 | - | HPRD | 8521472|9045618 |
| RASA1 | CM-AVM | CMAVM | DKFZp434N071 | GAP | PKWS | RASA | RASGAP | p120GAP | p120RASGAP | RAS p21 protein activator (GTPase activating protein) 1 | - | HPRD | 11536198 |
| RIN1 | - | Ras and Rab interactor 1 | - | HPRD,BioGRID | 11703925 |
| RIN2 | RASSF4 | Ras and Rab interactor 2 | - | HPRD | 12972505 |
| RIN2 | RASSF4 | Ras and Rab interactor 2 | Two-hybrid | BioGRID | 11733506 |
| RIN3 | DKFZp762H1613 | FLJ11700 | FLJ22439 | Ras and Rab interactor 3 | Two-hybrid | BioGRID | 12972505 |
| RIT2 | RIBA | RIN | ROC2 | Ras-like without CAAX 2 | Biochemical Activity | BioGRID | 11703925 |
| SDCBP | MDA-9 | ST1 | SYCL | TACIP18 | syndecan binding protein (syntenin) | Affinity Capture-Western Two-hybrid | BioGRID | 15014045 |
| STX4 | STX4A | p35-2 | syntaxin 4 | - | HPRD,BioGRID | 11884531 |
| TBC1D3 | TBC1D3A | TRE17 | TBC1 domain family, member 3 | - | HPRD | 12612085 |
| TBC1D3C | FLJ78248 | MGC44903 | TBC1 domain family, member 3C | - | HPRD | 12359748 |
| TSC2 | FLJ43106 | LAM | TSC4 | tuberous sclerosis 2 | - | HPRD | 9045618 |
| TSC2 | FLJ43106 | LAM | TSC4 | tuberous sclerosis 2 | Co-purification | BioGRID | 12147258 |
| VPS45 | H1 | H1VPS45 | VPS45A | VPS45B | VPS54A | VSP45 | VSP45A | vacuolar protein sorting 45 homolog (S. cerevisiae) | Affinity Capture-MS | BioGRID | 11062261 |
| ZFYVE20 | FLJ34993 | MGC126210 | Rabenosyn-5 | zinc finger, FYVE domain containing 20 | - | HPRD,BioGRID | 11062261 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG ENDOCYTOSIS | 183 | 132 | All SZGR 2.0 genes in this pathway |
| KEGG VASOPRESSIN REGULATED WATER REABSORPTION | 44 | 30 | All SZGR 2.0 genes in this pathway |
| KEGG AMYOTROPHIC LATERAL SCLEROSIS ALS | 53 | 43 | All SZGR 2.0 genes in this pathway |
| BIOCARTA PTDINS PATHWAY | 23 | 16 | All SZGR 2.0 genes in this pathway |
| BIOCARTA RAB PATHWAY | 12 | 8 | All SZGR 2.0 genes in this pathway |
| PID MET PATHWAY | 80 | 60 | All SZGR 2.0 genes in this pathway |
| PID AJDISS 2PATHWAY | 48 | 38 | All SZGR 2.0 genes in this pathway |
| PID ERBB1 DOWNSTREAM PATHWAY | 105 | 78 | All SZGR 2.0 genes in this pathway |
| PID PDGFRB PATHWAY | 129 | 103 | All SZGR 2.0 genes in this pathway |
| PID IL8 CXCR2 PATHWAY | 34 | 26 | All SZGR 2.0 genes in this pathway |
| PID ERBB1 INTERNALIZATION PATHWAY | 41 | 35 | All SZGR 2.0 genes in this pathway |
| PID P38 ALPHA BETA DOWNSTREAM PATHWAY | 38 | 29 | All SZGR 2.0 genes in this pathway |
| PID IL8 CXCR1 PATHWAY | 28 | 19 | All SZGR 2.0 genes in this pathway |
| REACTOME FACTORS INVOLVED IN MEGAKARYOCYTE DEVELOPMENT AND PLATELET PRODUCTION | 132 | 101 | All SZGR 2.0 genes in this pathway |
| REACTOME HEMOSTASIS | 466 | 331 | All SZGR 2.0 genes in this pathway |
| THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC2 TARGETS UP | 114 | 66 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
| LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
| CAFFAREL RESPONSE TO THC UP | 33 | 20 | All SZGR 2.0 genes in this pathway |
| CAFFAREL RESPONSE TO THC 24HR 5 UP | 34 | 23 | All SZGR 2.0 genes in this pathway |
| BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
| BENPORATH OCT4 TARGETS | 290 | 172 | All SZGR 2.0 genes in this pathway |
| BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
| BENPORATH NOS TARGETS | 179 | 105 | All SZGR 2.0 genes in this pathway |
| PENG GLUCOSE DEPRIVATION DN | 169 | 112 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 20HR UP | 240 | 152 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 16HR UP | 225 | 139 | All SZGR 2.0 genes in this pathway |
| DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP | 314 | 201 | All SZGR 2.0 genes in this pathway |
| LU AGING BRAIN DN | 153 | 120 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 8HR UP | 105 | 73 | All SZGR 2.0 genes in this pathway |
| YIH RESPONSE TO ARSENITE C2 | 18 | 15 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RESPONSE TO TRABECTEDIN DN | 271 | 175 | All SZGR 2.0 genes in this pathway |
| ACEVEDO NORMAL TISSUE ADJACENT TO LIVER TUMOR DN | 354 | 216 | All SZGR 2.0 genes in this pathway |
| BLUM RESPONSE TO SALIRASIB UP | 245 | 159 | All SZGR 2.0 genes in this pathway |
| LINDSTEDT DENDRITIC CELL MATURATION A | 67 | 52 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
| ROME INSULIN TARGETS IN MUSCLE UP | 442 | 263 | All SZGR 2.0 genes in this pathway |
| SASSON RESPONSE TO GONADOTROPHINS UP | 91 | 59 | All SZGR 2.0 genes in this pathway |
| SASSON RESPONSE TO FORSKOLIN DN | 88 | 68 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| AZARE NEOPLASTIC TRANSFORMATION BY STAT3 UP | 121 | 70 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-101 | 884 | 891 | 1A,m8 | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
| miR-130/301 | 1162 | 1169 | 1A,m8 | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
| hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
| hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
| hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
| hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU | ||||
| hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
| hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
| hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
| miR-144 | 885 | 891 | 1A | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.