Gene Page: RDX
Summary ?
GeneID | 5962 |
Symbol | RDX |
Synonyms | DFNB24 |
Description | radixin |
Reference | MIM:179410|HGNC:HGNC:9944|Ensembl:ENSG00000137710|HPRD:01534|Vega:OTTHUMG00000166574 |
Gene type | protein-coding |
Map location | 11q23 |
Pascal p-value | 0.547 |
Sherlock p-value | 0.401 |
DEG p-value | DEG:Zhao_2015:p=3.25e-04:q=0.0924 |
Fetal beta | 1.38 |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DEG:Zhao_2015 | RNA Sequencing analysis | Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.006 | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs1076773 | chr1 | 37136422 | RDX | 5962 | 0.17 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AC097382.4 | 0.85 | 0.86 |
YY1 | 0.82 | 0.85 |
ZBTB9 | 0.81 | 0.83 |
SNIP1 | 0.81 | 0.84 |
POLR1B | 0.81 | 0.83 |
CSTF2T | 0.81 | 0.81 |
KLHL20 | 0.81 | 0.83 |
CRK | 0.81 | 0.85 |
AGPAT6 | 0.81 | 0.83 |
AP003115.1 | 0.81 | 0.82 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MT-CO2 | -0.68 | -0.76 |
AF347015.31 | -0.67 | -0.75 |
FXYD1 | -0.65 | -0.72 |
AF347015.27 | -0.65 | -0.73 |
MT-CYB | -0.63 | -0.72 |
AF347015.33 | -0.63 | -0.69 |
AF347015.21 | -0.63 | -0.74 |
IFI27 | -0.63 | -0.68 |
AF347015.8 | -0.63 | -0.73 |
HIGD1B | -0.62 | -0.71 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003779 | actin binding | IEA | - | |
GO:0005198 | structural molecule activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007605 | sensory perception of sound | IEA | - | |
GO:0051016 | barbed-end actin filament capping | IEA | - | |
GO:0030033 | microvillus biogenesis | IEA | - | |
GO:0045176 | apical protein localization | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0030175 | filopodium | IEA | axon (GO term level: 5) | - |
GO:0001726 | ruffle | IEA | - | |
GO:0005856 | cytoskeleton | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0030027 | lamellipodium | IEA | - | |
GO:0005886 | plasma membrane | IEA | - | |
GO:0019898 | extrinsic to membrane | IEA | - | |
GO:0032420 | stereocilium | IEA | - | |
GO:0045177 | apical part of cell | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ABCC2 | ABC30 | CMOAT | DJS | KIAA1010 | MRP2 | cMRP | ATP-binding cassette, sub-family C (CFTR/MRP), member 2 | - | HPRD | 12068294 |
ARHGDIA | GDIA1 | MGC117248 | RHOGDI | RHOGDI-1 | Rho GDP dissociation inhibitor (GDI) alpha | - | HPRD,BioGRID | 9287351 |
CPNE1 | COPN1 | CPN1 | MGC1142 | copine I | - | HPRD | 12522145 |
CPNE2 | COPN2 | CPN2 | DKFZp686E06199 | MGC16924 | copine II | - | HPRD | 12522145 |
CPNE4 | COPN4 | CPN4 | MGC15604 | copine IV | - | HPRD | 12522145 |
DRD3 | D3DR | ETM1 | FET1 | MGC149204 | MGC149205 | dopamine receptor D3 | Two-hybrid | BioGRID | 14499480 |
EZR | CVIL | CVL | DKFZp762H157 | FLJ26216 | MGC1584 | VIL2 | ezrin | - | HPRD | 9501018 |
GNA13 | G13 | MGC46138 | guanine nucleotide binding protein (G protein), alpha 13 | Affinity Capture-Western Reconstituted Complex Two-hybrid | BioGRID | 10816569 |
ICAM2 | CD102 | intercellular adhesion molecule 2 | - | HPRD,BioGRID | 11375520 |
L1CAM | CAML1 | CD171 | HSAS | HSAS1 | MASA | MIC5 | N-CAML1 | S10 | SPG1 | L1 cell adhesion molecule | - | HPRD | 12070130 |
SLC9A3R1 | EBP50 | NHERF | NHERF1 | NPHLOP2 | solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1 | Radixin interacts with hNHE-RF. This interaction was modeled on a demonstrated interaction between chicken radixin and human hNHE-RF. | BIND | 9430655 |
SLC9A3R1 | EBP50 | NHERF | NHERF1 | NPHLOP2 | solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1 | - | HPRD | 9430655|12499563 |
SLC9A3R2 | E3KARP | MGC104639 | NHE3RF2 | NHERF-2 | NHERF2 | OCTS2 | SIP-1 | SIP1 | TKA-1 | solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2 | - | HPRD | 12499563 |
TSC1 | KIAA0243 | LAM | MGC86987 | TSC | tuberous sclerosis 1 | Hamartin interacts with radixin. This interaction was modeled on a demonstrated interaction between murine hamartin and human radixin. | BIND | 10806479 |
TSC1 | KIAA0243 | LAM | MGC86987 | TSC | tuberous sclerosis 1 | - | HPRD | 10806479|12226091 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG REGULATION OF ACTIN CYTOSKELETON | 216 | 144 | All SZGR 2.0 genes in this pathway |
ST GA13 PATHWAY | 37 | 32 | All SZGR 2.0 genes in this pathway |
PID RHOA PATHWAY | 45 | 33 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
REACTOME L1CAM INTERACTIONS | 86 | 62 | All SZGR 2.0 genes in this pathway |
REACTOME RECYCLING PATHWAY OF L1 | 27 | 15 | All SZGR 2.0 genes in this pathway |
PARENT MTOR SIGNALING UP | 567 | 375 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
FRASOR TAMOXIFEN RESPONSE UP | 51 | 36 | All SZGR 2.0 genes in this pathway |
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN | 493 | 298 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN | 463 | 290 | All SZGR 2.0 genes in this pathway |
THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN | 320 | 184 | All SZGR 2.0 genes in this pathway |
GRABARCZYK BCL11B TARGETS UP | 81 | 40 | All SZGR 2.0 genes in this pathway |
RODRIGUES NTN1 TARGETS UP | 17 | 11 | All SZGR 2.0 genes in this pathway |
WANG LMO4 TARGETS DN | 352 | 225 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LPS UP | 431 | 237 | All SZGR 2.0 genes in this pathway |
JAATINEN HEMATOPOIETIC STEM CELL UP | 316 | 190 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
HAMAI APOPTOSIS VIA TRAIL UP | 584 | 356 | All SZGR 2.0 genes in this pathway |
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
GRUETZMANN PANCREATIC CANCER DN | 203 | 134 | All SZGR 2.0 genes in this pathway |
SIMBULAN UV RESPONSE IMMORTALIZED DN | 31 | 26 | All SZGR 2.0 genes in this pathway |
RICKMAN METASTASIS DN | 261 | 155 | All SZGR 2.0 genes in this pathway |
BENPORATH PROLIFERATION | 147 | 80 | All SZGR 2.0 genes in this pathway |
SHEN SMARCA2 TARGETS UP | 424 | 268 | All SZGR 2.0 genes in this pathway |
ASTON MAJOR DEPRESSIVE DISORDER DN | 160 | 110 | All SZGR 2.0 genes in this pathway |
ROSS AML OF FAB M7 TYPE | 68 | 44 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
JIANG AGING CEREBRAL CORTEX UP | 36 | 27 | All SZGR 2.0 genes in this pathway |
LU AGING BRAIN UP | 262 | 186 | All SZGR 2.0 genes in this pathway |
WELCSH BRCA1 TARGETS UP | 198 | 132 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
CLASPER LYMPHATIC VESSELS DURING METASTASIS DN | 36 | 23 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
AMUNDSON POOR SURVIVAL AFTER GAMMA RADIATION 8G | 95 | 62 | All SZGR 2.0 genes in this pathway |
DAIRKEE CANCER PRONE RESPONSE BPA | 51 | 35 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER UP | 973 | 570 | All SZGR 2.0 genes in this pathway |
BOCHKIS FOXA2 TARGETS | 425 | 261 | All SZGR 2.0 genes in this pathway |
LABBE WNT3A TARGETS UP | 112 | 71 | All SZGR 2.0 genes in this pathway |
WANG TUMOR INVASIVENESS UP | 374 | 247 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO CSF2RB AND IL4 UP | 338 | 225 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF UP | 418 | 282 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 UP | 408 | 276 | All SZGR 2.0 genes in this pathway |
VANTVEER BREAST CANCER ESR1 DN | 240 | 153 | All SZGR 2.0 genes in this pathway |
ZHANG TLX TARGETS 60HR DN | 277 | 166 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA PCA3 DN | 69 | 38 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 11 | 103 | 68 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 974 | 981 | 1A,m8 | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-132/212 | 1859 | 1865 | m8 | hsa-miR-212SZ | UAACAGUCUCCAGUCACGGCC |
hsa-miR-132brain | UAACAGUCUACAGCCAUGGUCG | ||||
miR-182 | 91 | 98 | 1A,m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-196 | 973 | 979 | m8 | hsa-miR-196a | UAGGUAGUUUCAUGUUGUUGG |
hsa-miR-196b | UAGGUAGUUUCCUGUUGUUGG | ||||
miR-31 | 90 | 96 | 1A | hsa-miR-31 | AGGCAAGAUGCUGGCAUAGCUG |
miR-34b | 1129 | 1135 | m8 | hsa-miR-34b | UAGGCAGUGUCAUUAGCUGAUUG |
miR-410 | 2107 | 2113 | m8 | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
miR-493-5p | 2345 | 2351 | 1A | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
miR-96 | 92 | 98 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.