SZGR2

Summary ?

GeneID	613
Symbol	BCR
Synonyms	ALL\|BCR1\|CML\|D22S11\|D22S662\|PHL
Description	breakpoint cluster region
Reference	MIM:151410\|HGNC:HGNC:1014\|Ensembl:ENSG00000186716\|HPRD:01044\|Vega:OTTHUMG00000150655
Gene type	protein-coding
Map location	22q11.23
Pascal p-value	0.773
Sherlock p-value	0.524
Fetal beta	-0.386
eGene	Anterior cingulate cortex BA24 Caudate basal ganglia Cerebellar Hemisphere Cerebellum Cortex Frontal Cortex BA9 Hippocampus Hypothalamus Nucleus accumbens basal ganglia Putamen basal ganglia Meta
Support	G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I	Genome scan meta-analysis	Psr: 0.031
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.1296

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	TSS distance	eQTL type
rs131684	22	23646257	BCR	ENSG00000186716.15	1.785E-8	124366	gtex_brain_ba24
rs140507	22	23646512	BCR	ENSG00000186716.15	1.785E-8	124621	gtex_brain_ba24
rs131686	22	23646953	BCR	ENSG00000186716.15	1.785E-8	125062	gtex_brain_ba24
rs131689	22	23647845	BCR	ENSG00000186716.15	1.788E-7	125954	gtex_brain_ba24
rs131690	22	23648009	BCR	ENSG00000186716.15	1.786E-8	126118	gtex_brain_ba24
rs131691	22	23648625	BCR	ENSG00000186716.15	1.51E-8	126734	gtex_brain_ba24
rs140508	22	23648913	BCR	ENSG00000186716.15	1.785E-7	127022	gtex_brain_ba24
rs131693	22	23649242	BCR	ENSG00000186716.15	1.796E-8	127351	gtex_brain_ba24
rs149904420	22	23649868	BCR	ENSG00000186716.15	3.245E-8	127977	gtex_brain_ba24
rs28405226	22	23649994	BCR	ENSG00000186716.15	1.225E-8	128103	gtex_brain_ba24
rs131703	22	23652201	BCR	ENSG00000186716.15	1.294E-7	130310	gtex_brain_ba24
rs140509	22	23652212	BCR	ENSG00000186716.15	1.299E-7	130321	gtex_brain_ba24
rs180797	22	23652956	BCR	ENSG00000186716.15	1.944E-7	131065	gtex_brain_ba24
rs180801	22	23653880	BCR	ENSG00000186716.15	1.246E-7	131989	gtex_brain_ba24
rs180805	22	23654993	BCR	ENSG00000186716.15	5.211E-8	133102	gtex_brain_ba24
rs180806	22	23655219	BCR	ENSG00000186716.15	1.317E-7	133328	gtex_brain_ba24
rs180810	22	23657477	BCR	ENSG00000186716.15	1.273E-7	135586	gtex_brain_ba24
rs180811	22	23657495	BCR	ENSG00000186716.15	1.371E-6	135604	gtex_brain_ba24
rs180812	22	23657735	BCR	ENSG00000186716.15	1.457E-7	135844	gtex_brain_ba24
rs392389	22	23657874	BCR	ENSG00000186716.15	1.507E-7	135983	gtex_brain_ba24
rs440531	22	23657875	BCR	ENSG00000186716.15	1.507E-7	135984	gtex_brain_ba24
rs113629387	22	23657939	BCR	ENSG00000186716.15	5.657E-7	136048	gtex_brain_ba24
rs28379041	22	23657966	BCR	ENSG00000186716.15	1.469E-7	136075	gtex_brain_ba24
rs180816	22	23657980	BCR	ENSG00000186716.15	1.29E-7	136089	gtex_brain_ba24
rs180817	22	23658007	BCR	ENSG00000186716.15	1.182E-7	136116	gtex_brain_ba24
rs201326729	22	23662657	BCR	ENSG00000186716.15	5.284E-7	140766	gtex_brain_ba24
rs12163260	22	23662671	BCR	ENSG00000186716.15	5.636E-8	140780	gtex_brain_ba24
rs4632463	22	23662897	BCR	ENSG00000186716.15	5.757E-7	141006	gtex_brain_ba24
rs4822384	22	23663848	BCR	ENSG00000186716.15	2.012E-7	141957	gtex_brain_ba24
rs131684	22	23646257	BCR	ENSG00000186716.15	6.52E-8	124366	gtex_brain_putamen_basal
rs140507	22	23646512	BCR	ENSG00000186716.15	5.125E-8	124621	gtex_brain_putamen_basal
rs131686	22	23646953	BCR	ENSG00000186716.15	3.399E-8	125062	gtex_brain_putamen_basal
rs131689	22	23647845	BCR	ENSG00000186716.15	6.637E-8	125954	gtex_brain_putamen_basal
rs131690	22	23648009	BCR	ENSG00000186716.15	1.56E-8	126118	gtex_brain_putamen_basal
rs131691	22	23648625	BCR	ENSG00000186716.15	1.37E-8	126734	gtex_brain_putamen_basal
rs140508	22	23648913	BCR	ENSG00000186716.15	6.63E-8	127022	gtex_brain_putamen_basal
rs131693	22	23649242	BCR	ENSG00000186716.15	1.505E-8	127351	gtex_brain_putamen_basal
rs149904420	22	23649868	BCR	ENSG00000186716.15	4.142E-8	127977	gtex_brain_putamen_basal
rs28405226	22	23649994	BCR	ENSG00000186716.15	1.377E-8	128103	gtex_brain_putamen_basal
rs131703	22	23652201	BCR	ENSG00000186716.15	8.154E-13	130310	gtex_brain_putamen_basal
rs140509	22	23652212	BCR	ENSG00000186716.15	8.101E-13	130321	gtex_brain_putamen_basal
rs180797	22	23652956	BCR	ENSG00000186716.15	1.237E-12	131065	gtex_brain_putamen_basal
rs180801	22	23653880	BCR	ENSG00000186716.15	1.153E-12	131989	gtex_brain_putamen_basal
rs56024092	22	23654807	BCR	ENSG00000186716.15	1.382E-6	132916	gtex_brain_putamen_basal
rs180805	22	23654993	BCR	ENSG00000186716.15	1.233E-12	133102	gtex_brain_putamen_basal
rs11558697	22	23655084	BCR	ENSG00000186716.15	1.155E-6	133193	gtex_brain_putamen_basal
rs180806	22	23655219	BCR	ENSG00000186716.15	3.123E-12	133328	gtex_brain_putamen_basal
rs66569843	22	23656148	BCR	ENSG00000186716.15	1.109E-6	134257	gtex_brain_putamen_basal
rs180809	22	23657326	BCR	ENSG00000186716.15	5.684E-8	135435	gtex_brain_putamen_basal
rs180810	22	23657477	BCR	ENSG00000186716.15	2.953E-9	135586	gtex_brain_putamen_basal
rs180811	22	23657495	BCR	ENSG00000186716.15	8.444E-11	135604	gtex_brain_putamen_basal
rs180812	22	23657735	BCR	ENSG00000186716.15	3.142E-12	135844	gtex_brain_putamen_basal
rs392389	22	23657874	BCR	ENSG00000186716.15	3.057E-12	135983	gtex_brain_putamen_basal
rs440531	22	23657875	BCR	ENSG00000186716.15	3.057E-12	135984	gtex_brain_putamen_basal
rs113629387	22	23657939	BCR	ENSG00000186716.15	3.868E-12	136048	gtex_brain_putamen_basal
rs28379041	22	23657966	BCR	ENSG00000186716.15	1.227E-8	136075	gtex_brain_putamen_basal
rs180816	22	23657980	BCR	ENSG00000186716.15	6.116E-9	136089	gtex_brain_putamen_basal
rs180817	22	23658007	BCR	ENSG00000186716.15	1.91E-11	136116	gtex_brain_putamen_basal
rs2330350	22	23660942	BCR	ENSG00000186716.15	1.58E-8	139051	gtex_brain_putamen_basal
rs13057338	22	23660980	BCR	ENSG00000186716.15	2.706E-10	139089	gtex_brain_putamen_basal
rs9612293	22	23661273	BCR	ENSG00000186716.15	1.232E-9	139382	gtex_brain_putamen_basal
rs201326729	22	23662657	BCR	ENSG00000186716.15	1.815E-9	140766	gtex_brain_putamen_basal
rs12163260	22	23662671	BCR	ENSG00000186716.15	7.83E-10	140780	gtex_brain_putamen_basal
rs4632463	22	23662897	BCR	ENSG00000186716.15	6.085E-10	141006	gtex_brain_putamen_basal
rs8140083	22	23663722	BCR	ENSG00000186716.15	1.471E-10	141831	gtex_brain_putamen_basal
rs13053509	22	23663772	BCR	ENSG00000186716.15	9.671E-7	141881	gtex_brain_putamen_basal
rs4822384	22	23663848	BCR	ENSG00000186716.15	9.318E-10	141957	gtex_brain_putamen_basal

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005089	Rho guanyl-nucleotide exchange factor activity	IEA		-
GO:0005085	guanyl-nucleotide exchange factor activity	IEA		-
GO:0005096	GTPase activator activity	NAS		-
GO:0005096	GTPase activator activity	TAS		1903516
GO:0004674	protein serine/threonine kinase activity	NAS		-
GO:0004674	protein serine/threonine kinase activity	TAS		1657398
GO:0016740	transferase activity	IEA		-
GO:0016301	kinase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007420	brain development	IEA	Brain (GO term level: 7)	-
GO:0006468	protein amino acid phosphorylation	TAS		1657398
GO:0007242	intracellular signaling cascade	IEA		-
GO:0007242	intracellular signaling cascade	NAS		-
GO:0035023	regulation of Rho protein signal transduction	IEA		-
GO:0051726	regulation of cell cycle	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005575	cellular_component	ND		-
GO:0005622	intracellular	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ABL1	ABL \| JTK7 \| bcr/abl \| c-ABL \| p150 \| v-abl	c-abl oncogene 1, receptor tyrosine kinase	BCR interacts with c-Abl. This interaction was modeled on a demonstrated interaction between BCR from an unspecified source and human c-Abl.	BIND	1383690
ABL1	ABL \| JTK7 \| bcr/abl \| c-ABL \| p150 \| v-abl	c-abl oncogene 1, receptor tyrosine kinase	-	HPRD	11780146
ABL1	ABL \| JTK7 \| bcr/abl \| c-ABL \| p150 \| v-abl	c-abl oncogene 1, receptor tyrosine kinase	Affinity Capture-Western Reconstituted Complex	BioGRID	1712671 \|8112292 \|12543778
ABL2	ABLL \| ARG \| FLJ22224 \| FLJ31718 \| FLJ41441	v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)	BCR interacts with ARG. This interaction was modeled on a demonstrated interaction between BCR from an unspecified source and human ARG.	BIND	1383690
BCR	ALL \| BCR-ABL1 \| BCR1 \| CML \| D22S11 \| D22S662 \| FLJ16453 \| PHL	breakpoint cluster region	-	HPRD	11780146
BCR	ALL \| BCR-ABL1 \| BCR1 \| CML \| D22S11 \| D22S662 \| FLJ16453 \| PHL	breakpoint cluster region	p210 Bcr-Abl phosphorylates p160 Bcr.	BIND	8112292
BLK	MGC10442	B lymphoid tyrosine kinase	-	HPRD	8756631
CBL	C-CBL \| CBL2 \| RNF55	Cas-Br-M (murine) ecotropic retroviral transforming sequence	Co-purification	BioGRID	8641358
CRKL	-	v-crk sarcoma virus CT10 oncogene homolog (avian)-like	Affinity Capture-Western Far Western Two-hybrid	BioGRID	8978305 \|9747873 \|10194128 \|15143164
ERCC3	BTF2 \| GTF2H \| RAD25 \| TFIIH \| XPB	excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing)	-	HPRD,BioGRID	9874796
FES	FPS	feline sarcoma oncogene	-	HPRD,BioGRID	7529874
GAB2	KIAA0571	GRB2-associated binding protein 2	Affinity Capture-Western	BioGRID	15143164
GRB10	GRB-IR \| Grb-10 \| IRBP \| KIAA0207 \| MEG1 \| RSS	growth factor receptor-bound protein 10	-	HPRD,BioGRID	9747873
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	Grb2 interacts with Bcr-Abl.	BIND	9872323
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	-	HPRD,BioGRID	8112292 \|9178913
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	Tyrosine phosphorylated Bcr-Abl interacts with Grb2.	BIND	8112292
HCK	JTK9	hemopoietic cell kinase	Affinity Capture-Western	BioGRID	10849448 \|12592324
HOXA9	ABD-B \| HOX1 \| HOX1.7 \| HOX1G \| MGC1934	homeobox A9	Phenotypic Enhancement	BioGRID	12393433
IGSF21	FLJ41177 \| MGC15730	immunoglobin superfamily, member 21	Two-hybrid	BioGRID	16169070
JAK2	JTK10	Janus kinase 2 (a protein tyrosine kinase)	-	HPRD,BioGRID	12023981 \|12370803
KIT	C-Kit \| CD117 \| PBT \| SCFR	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	Affinity Capture-Western	BioGRID	8757502
MAP4K5	GCKR \| KHS \| KHS1 \| MAPKKKK5	mitogen-activated protein kinase kinase kinase kinase 5	-	HPRD	9949177
MLLT4	AF-6 \| AF6 \| AFADIN \| FLJ34371 \| RP3-431P23.3	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	-	HPRD,BioGRID	12808105
NCK2	GRB4 \| NCKbeta	NCK adaptor protein 2	-	HPRD	10887126
PIK3CG	PI3CG \| PI3K \| PI3Kgamma \| PIK3	phosphoinositide-3-kinase, catalytic, gamma polypeptide	Affinity Capture-Western Co-purification Two-hybrid	BioGRID	7606002 \|8641358 \|9747873
PLCG1	PLC-II \| PLC1 \| PLC148 \| PLCgamma1	phospholipase C, gamma 1	BCR interacts with PLCgamma1. This interaction was modeled on a demonstrated interaction between BCR from an unspecified source and bovine PLCgamma1.	BIND	1383690
PTPN11	BPTP3 \| CFC \| MGC14433 \| NS1 \| PTP-1D \| PTP2C \| SH-PTP2 \| SH-PTP3 \| SHP2	protein tyrosine phosphatase, non-receptor type 11	Phosphorylated p210bcr-abl interacts with phosphorylated Syp. This interaction was modeled on a demonstrated interaction between human p210bcr-abl and mouse Syp.	BIND	8195176
PTPN11	BPTP3 \| CFC \| MGC14433 \| NS1 \| PTP-1D \| PTP2C \| SH-PTP2 \| SH-PTP3 \| SHP2	protein tyrosine phosphatase, non-receptor type 11	-	HPRD	12115002
PTPN6	HCP \| HCPH \| HPTP1C \| PTP-1C \| SH-PTP1 \| SHP-1 \| SHP-1L \| SHP1	protein tyrosine phosphatase, non-receptor type 6	-	HPRD,BioGRID	9211920
PXN	FLJ16691	paxillin	Affinity Capture-Western Co-purification	BioGRID	7534286 \|8641358
RASA1	CM-AVM \| CMAVM \| DKFZp434N071 \| GAP \| PKWS \| RASA \| RASGAP \| p120GAP \| p120RASGAP	RAS p21 protein activator (GTPase activating protein) 1	BCR interacts with GAP. This interaction was modeled on a demonstrated interaction between BCR from an unspecified source and human GAP.	BIND	1383690
RB1	OSRC \| RB \| p105-Rb \| pRb \| pp110	retinoblastoma 1	Affinity Capture-Western	BioGRID	9071815
SH2B1	DKFZp547G1110 \| FLJ30542 \| KIAA1299 \| SH2-B \| SH2B	SH2B adaptor protein 1	Affinity Capture-Western	BioGRID	12370803
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	-	HPRD,BioGRID	9209414
SOS1	GF1 \| GGF1 \| GINGF \| HGF \| NS4	son of sevenless homolog 1 (Drosophila)	Affinity Capture-Western	BioGRID	8112292
SRC	ASV \| SRC1 \| c-SRC \| p60-Src	v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)	BCR interacts with Src. This interaction was modeled on a demonstrated interaction between BCR from an unspecified source and Src from Rous Sarcoma virus.	BIND	1383690
TLN1	ILWEQ \| KIAA1027 \| TLN	talin 1	Co-purification	BioGRID	8641358
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	Two-hybrid	BioGRID	16169070
UNC119	HRG4	unc-119 homolog (C. elegans)	Two-hybrid	BioGRID	16169070
VAV1	VAV	vav 1 guanine nucleotide exchange factor	-	HPRD	11790798
YWHAZ	KCIP-1 \| MGC111427 \| MGC126532 \| MGC138156	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide	-	HPRD	7939633

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG CHRONIC MYELOID LEUKEMIA	73	59	All SZGR 2.0 genes in this pathway
BIOCARTA GLEEVEC PATHWAY	23	17	All SZGR 2.0 genes in this pathway
BIOCARTA INTEGRIN PATHWAY	38	29	All SZGR 2.0 genes in this pathway
SA B CELL RECEPTOR COMPLEXES	24	20	All SZGR 2.0 genes in this pathway
SIG PIP3 SIGNALING IN B LYMPHOCYTES	36	31	All SZGR 2.0 genes in this pathway
SIG BCR SIGNALING PATHWAY	46	38	All SZGR 2.0 genes in this pathway
ST B CELL ANTIGEN RECEPTOR	40	32	All SZGR 2.0 genes in this pathway
PID RHOA REG PATHWAY	46	30	All SZGR 2.0 genes in this pathway
PID RAC1 REG PATHWAY	38	25	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY RHO GTPASES	113	81	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY FGFR IN DISEASE	127	88	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY FGFR1 MUTANTS	30	20	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY FGFR1 FUSION MUTANTS	19	12	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY FGFR MUTANTS	44	29	All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN	634	384	All SZGR 2.0 genes in this pathway
HOLLMANN APOPTOSIS VIA CD40 DN	267	178	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA DN	116	79	All SZGR 2.0 genes in this pathway
LIU CMYB TARGETS UP	165	106	All SZGR 2.0 genes in this pathway
LIU VMYB TARGETS UP	127	78	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP	450	256	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 DN	242	165	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 DN	281	186	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN	805	505	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP	552	347	All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND SERUM DEPRIVATION UP	211	136	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
BARRIER CANCER RELAPSE NORMAL SAMPLE DN	31	19	All SZGR 2.0 genes in this pathway
MYLLYKANGAS AMPLIFICATION HOT SPOT 22	13	9	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE AUGMENTED BY MYC	108	74	All SZGR 2.0 genes in this pathway
RICKMAN METASTASIS DN	261	155	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP	398	262	All SZGR 2.0 genes in this pathway
FAELT B CLL WITH VH3 21 UP	44	30	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN	911	527	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN	1011	592	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN	543	317	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 3D UP	210	124	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
NUTT GBM VS AO GLIOMA DN	45	22	All SZGR 2.0 genes in this pathway
AGUIRRE PANCREATIC CANCER COPY NUMBER DN	238	145	All SZGR 2.0 genes in this pathway
ZHAN VARIABLE EARLY DIFFERENTIATION GENES UP	15	9	All SZGR 2.0 genes in this pathway
YAGI AML WITH T 8 21 TRANSLOCATION	368	247	All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS UP	387	225	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE	1137	655	All SZGR 2.0 genes in this pathway
LINSLEY MIR16 TARGETS	206	127	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP	682	433	All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN	321	200	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway
HOLLEMAN ASPARAGINASE RESISTANCE B ALL UP	26	15	All SZGR 2.0 genes in this pathway
HOLLEMAN ASPARAGINASE RESISTANCE ALL UP	22	14	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-145	2008	2015	1A,m8	hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCUU
miR-15/16/195/424/497	419	425	m8	hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
miR-181	1059	1065	1A	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-26	983	990	1A,m8	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	983	990	1A,m8	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-96	2034	2040	m8	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: BCR