Gene Page: SHOX2
Summary ?
| GeneID | 6474 |
| Symbol | SHOX2 |
| Synonyms | OG12|OG12X|SHOT |
| Description | short stature homeobox 2 |
| Reference | MIM:602504|HGNC:HGNC:10854|Ensembl:ENSG00000168779|Vega:OTTHUMG00000158755 |
| Gene type | protein-coding |
| Map location | 3q25.32 |
| Pascal p-value | 0.73 |
| TADA p-value | 0.01 |
| Fetal beta | 0.176 |
| Support | CompositeSet |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| SHOX2 | chr3 | 157815881 | T | C | NM_001163678 NM_003030 NM_006884 | p.299K>E p.335K>E p.311K>E | missense missense missense | Schizophrenia | DNM:Fromer_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AC008622.1 | 0.92 | 0.80 |
| TEAD2 | 0.89 | 0.68 |
| TP53 | 0.88 | 0.76 |
| TCF19 | 0.88 | 0.80 |
| BTG1 | 0.87 | 0.82 |
| CDCA7 | 0.87 | 0.80 |
| CDK2 | 0.87 | 0.69 |
| CDO1 | 0.87 | 0.72 |
| PTBP1 | 0.86 | 0.72 |
| KIF22 | 0.86 | 0.79 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| C5orf53 | -0.51 | -0.75 |
| FBXO2 | -0.48 | -0.59 |
| HLA-F | -0.48 | -0.64 |
| AIFM3 | -0.48 | -0.65 |
| AF347015.27 | -0.47 | -0.75 |
| AF347015.31 | -0.47 | -0.76 |
| CA4 | -0.47 | -0.68 |
| PTH1R | -0.47 | -0.63 |
| S100B | -0.46 | -0.69 |
| AF347015.33 | -0.46 | -0.74 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003700 | transcription factor activity | IEA | - | |
| GO:0043565 | sequence-specific DNA binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 9482898 |
| GO:0001501 | skeletal system development | TAS | 9482898 | |
| GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
| GO:0007507 | heart development | TAS | 9482898 | |
| GO:0007275 | multicellular organismal development | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| SCHUETZ BREAST CANCER DUCTAL INVASIVE UP | 351 | 230 | All SZGR 2.0 genes in this pathway |
| CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN | 460 | 312 | All SZGR 2.0 genes in this pathway |
| CHARAFE BREAST CANCER BASAL VS MESENCHYMAL DN | 50 | 36 | All SZGR 2.0 genes in this pathway |
| NADERI BREAST CANCER PROGNOSIS DN | 18 | 13 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 UP | 309 | 199 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN | 164 | 111 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
| COWLING MYCN TARGETS | 43 | 27 | All SZGR 2.0 genes in this pathway |
| LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
| BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
| BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
| CERVERA SDHB TARGETS 1 UP | 118 | 66 | All SZGR 2.0 genes in this pathway |
| MANALO HYPOXIA UP | 207 | 145 | All SZGR 2.0 genes in this pathway |
| DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP | 314 | 201 | All SZGR 2.0 genes in this pathway |
| HAN JNK SINGALING UP | 35 | 21 | All SZGR 2.0 genes in this pathway |
| BURTON ADIPOGENESIS 11 | 57 | 40 | All SZGR 2.0 genes in this pathway |
| BACOLOD RESISTANCE TO ALKYLATING AGENTS UP | 26 | 17 | All SZGR 2.0 genes in this pathway |
| MONNIER POSTRADIATION TUMOR ESCAPE DN | 373 | 196 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 COMMON UP | 77 | 47 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER LUMINAL B DN | 564 | 326 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
| BOQUEST STEM CELL UP | 260 | 174 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
| SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
| NAKAYAMA SOFT TISSUE TUMORS PCA2 UP | 87 | 50 | All SZGR 2.0 genes in this pathway |
| VERHAAK GLIOBLASTOMA CLASSICAL | 162 | 122 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 2 DN | 336 | 211 | All SZGR 2.0 genes in this pathway |
| PLASARI TGFB1 TARGETS 10HR DN | 244 | 157 | All SZGR 2.0 genes in this pathway |
| WANG MLL TARGETS | 289 | 188 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-129-5p | 861 | 867 | 1A | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
| hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
| miR-18 | 1427 | 1433 | 1A | hsa-miR-18a | UAAGGUGCAUCUAGUGCAGAUA |
| hsa-miR-18b | UAAGGUGCAUCUAGUGCAGUUA | ||||
| miR-214 | 920 | 926 | 1A | hsa-miR-214brain | ACAGCAGGCACAGACAGGCAG |
| miR-330 | 777 | 784 | 1A,m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
| miR-375 | 1489 | 1496 | 1A,m8 | hsa-miR-375 | UUUGUUCGUUCGGCUCGCGUGA |
| miR-494 | 1629 | 1635 | 1A | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
| miR-96 | 1955 | 1961 | m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.