SZGR2

Summary ?

GeneID	65055
Symbol	REEP1
Synonyms	C2orf23\|HMN5B\|SPG31\|Yip2a
Description	receptor accessory protein 1
Reference	MIM:609139\|HGNC:HGNC:25786\|Ensembl:ENSG00000068615\|HPRD:07810\|Vega:OTTHUMG00000130205
Gene type	protein-coding
Map location	2p11.2
Pascal p-value	0.305
Sherlock p-value	0.795
Fetal beta	1.081
DMG	1 (# studies)
eGene	Caudate basal ganglia Cerebellar Hemisphere Cerebellum Cortex Frontal Cortex BA9 Hippocampus Nucleus accumbens basal ganglia Putamen basal ganglia Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
GSMA_I	Genome scan meta-analysis	Psr: 0.0004

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg21569844	2	86564582	REEP1	3.37E-8	-0.016	1.01E-5	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs10994209	chr10	61877705	REEP1	65055		0.17		trans
rs71377068	2	86477840	REEP1	ENSG00000068615.12	3.588E-6	0.02	87366	gtex_brain_putamen_basal
rs397873792	2	86494130	REEP1	ENSG00000068615.12	3.307E-6	0.02	71076	gtex_brain_putamen_basal
rs2367233	2	86541666	REEP1	ENSG00000068615.12	1.065E-6	0.02	23540	gtex_brain_putamen_basal
rs6746198	2	86542113	REEP1	ENSG00000068615.12	1.314E-6	0.02	23093	gtex_brain_putamen_basal
rs11691122	2	86543595	REEP1	ENSG00000068615.12	2.841E-6	0.02	21611	gtex_brain_putamen_basal
rs10200619	2	86548848	REEP1	ENSG00000068615.12	1.314E-6	0.02	16358	gtex_brain_putamen_basal
rs7593440	2	86550657	REEP1	ENSG00000068615.12	1.314E-6	0.02	14549	gtex_brain_putamen_basal
rs4392258	2	86552577	REEP1	ENSG00000068615.12	1.314E-6	0.02	12629	gtex_brain_putamen_basal
rs6547674	2	86552919	REEP1	ENSG00000068615.12	2.836E-6	0.02	12287	gtex_brain_putamen_basal
rs11685863	2	86554484	REEP1	ENSG00000068615.12	1.314E-6	0.02	10722	gtex_brain_putamen_basal
rs11127029	2	86554625	REEP1	ENSG00000068615.12	2.97E-6	0.02	10581	gtex_brain_putamen_basal
rs1863051	2	86559148	REEP1	ENSG00000068615.12	2.374E-6	0.02	6058	gtex_brain_putamen_basal
rs1863052	2	86559358	REEP1	ENSG00000068615.12	1.313E-6	0.02	5848	gtex_brain_putamen_basal

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0031849	olfactory receptor binding	IMP		15550249
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0051205	protein insertion into membrane	IDA		15550249
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005737	cytoplasm	IDA		15550249
GO:0005739	mitochondrion	IEA		-
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	IEA		-
GO:0031966	mitochondrial membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
ONKEN UVEAL MELANOMA UP	783	507	All SZGR 2.0 genes in this pathway
WATANABE COLON CANCER MSI VS MSS DN	81	42	All SZGR 2.0 genes in this pathway
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS DN	68	49	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA DN	284	156	All SZGR 2.0 genes in this pathway
SCIBETTA KDM5B TARGETS DN	81	55	All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER LMP DN	199	124	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP	1821	933	All SZGR 2.0 genes in this pathway
EBAUER TARGETS OF PAX3 FOXO1 FUSION UP	207	128	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS	355	243	All SZGR 2.0 genes in this pathway
PEREZ TP53 AND TP63 TARGETS	205	145	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER BASAL VS LULMINAL	330	215	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE UP	134	93	All SZGR 2.0 genes in this pathway
KANG GIST WITH PDGFRA UP	50	27	All SZGR 2.0 genes in this pathway
RICKMAN HEAD AND NECK CANCER C	113	47	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES	648	385	All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215	893	528	All SZGR 2.0 genes in this pathway
CERVERA SDHB TARGETS 1 UP	118	66	All SZGR 2.0 genes in this pathway
LE EGR2 TARGETS UP	108	75	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD UP	131	87	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS LATE PROGENITOR	544	307	All SZGR 2.0 genes in this pathway
MCLACHLAN DENTAL CARIES DN	245	144	All SZGR 2.0 genes in this pathway
MCLACHLAN DENTAL CARIES UP	253	147	All SZGR 2.0 genes in this pathway
BILD E2F3 ONCOGENIC SIGNATURE	246	153	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 2	473	224	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5	482	296	All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP	430	288	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN	701	446	All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE S	162	86	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP	756	494	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP	548	370	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL	177	132	All SZGR 2.0 genes in this pathway
QI HYPOXIA	140	96	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS NOT VIA AKT1 UP	211	131	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS VIA AKT1 UP	281	183	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
PEDERSEN METASTASIS BY ERBB2 ISOFORM 1	46	33	All SZGR 2.0 genes in this pathway
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN	308	187	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	31	37	1A	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-124.1	106	113	1A,m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	106	112	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	106	112	1A	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-140	51	57	m8	hsa-miR-140^brain	AGUGGUUUUACCCUAUGGUAG
miR-182	2231	2237	1A	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-200bc/429	2848	2854	m8	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-204/211	259	266	1A,m8	hsa-miR-204^brain	UUCCCUUUGUCAUCCUAUGCCU
miR-204/211	259	266	1A,m8	hsa-miR-211	UUCCCUUUGUCAUCCUUCGCCU
miR-208	3083	3089	1A	hsa-miR-208	AUAAGACGAGCAAAAAGCUUGU
miR-214	386	392	1A	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG
miR-23	2482	2489	1A,m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	2482	2489	1A,m8	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-24	1460	1466	m8	hsa-miR-24^SZ	UGGCUCAGUUCAGCAGGAACAG
miR-24	1460	1466	m8	hsa-miR-24^SZ	UGGCUCAGUUCAGCAGGAACAG
miR-377	2719	2726	1A,m8	hsa-miR-377	AUCACACAAAGGCAACUUUUGU
miR-493-5p	394	400	m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-495	3049	3055	1A	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-499	3082	3089	1A,m8	hsa-miR-499	UUAAGACUUGCAGUGAUGUUUAA
miR-96	2231	2237	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: REEP1