SZGR2

Summary ?

GeneID	652
Symbol	BMP4
Synonyms	BMP2B\|BMP2B1\|MCOPS6\|OFC11\|ZYME
Description	bone morphogenetic protein 4
Reference	MIM:112262\|HGNC:HGNC:1071\|Ensembl:ENSG00000125378\|HPRD:00207\|Vega:OTTHUMG00000140303
Gene type	protein-coding
Map location	14q22-q23
Pascal p-value	0.711
Sherlock p-value	0.677
Fetal beta	-1.209
DMG	1 (# studies)
eGene	Cerebellar Hemisphere Cerebellum Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWAScat	Genome-wide Association Studies	This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg16277510	14	54421395	BMP4	2.38E-9	-0.026	1.79E-6	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs12885035	chr14	54175838	BMP4	652		0.07		cis

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
CHST5	0.58	0.67
MIB2	0.58	0.57
SLC25A28	0.57	0.59
DVL1	0.57	0.58
BX927359.1	0.57	0.61
TMEM175	0.57	0.60
DNAJB2	0.56	0.62
C14orf80	0.55	0.59
AMDHD2	0.55	0.58
PNPLA2	0.55	0.61

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
RPS4Y1	-0.30	-0.28
AF347015.21	-0.30	-0.14
GNG11	-0.29	-0.25
USP9Y	-0.29	-0.28
CLEC2B	-0.29	-0.13
IL32	-0.28	-0.26
AC137766.1	-0.27	-0.16
ZFY	-0.27	-0.26
PRKY	-0.27	-0.29
CYorf15A	-0.27	-0.27

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004871	signal transducer activity	TAS		9804553
GO:0005125	cytokine activity	IDA		14749725
GO:0005515	protein binding	IEA		-
GO:0008201	heparin binding	IEA		-
GO:0008083	growth factor activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0021978	telencephalon regionalization	IEA	Brain (GO term level: 10)	-
GO:0030900	forebrain development	IEA	Brain (GO term level: 8)	-
GO:0001525	angiogenesis	IEA		-
GO:0001658	ureteric bud branching	IEA		-
GO:0001934	positive regulation of protein amino acid phosphorylation	IDA		14749725
GO:0007281	germ cell development	IEA		-
GO:0007507	heart development	IEA		-
GO:0007500	mesodermal cell fate determination	IEA		-
GO:0007275	multicellular organismal development	IEA		-
GO:0042475	odontogenesis of dentine-containing tooth	IEA		-
GO:0021904	dorsoventral neural tube patterning	IEA		-
GO:0030501	positive regulation of bone mineralization	IDA		14749725
GO:0030509	BMP signaling pathway	IEA		-
GO:0051216	cartilage development	IEA		-
GO:0030218	erythrocyte differentiation	IEA		-
GO:0043010	camera-type eye development	IEA		-
GO:0032331	negative regulation of chondrocyte differentiation	IEA		-
GO:0051145	smooth muscle cell differentiation	IEA		-
GO:0030324	lung development	IEA		-
GO:0040007	growth	IEA		-
GO:0045165	cell fate commitment	IEA		-
GO:0045662	negative regulation of myoblast differentiation	IDA		14749725
GO:0045843	negative regulation of striated muscle development	IDA		14749725
GO:0045786	negative regulation of cell cycle	IDA		11502704
GO:0045669	positive regulation of osteoblast differentiation	IDA		14749725
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005576	extracellular region	IEA		-
GO:0005578	proteinaceous extracellular matrix	IEA		-
GO:0005615	extracellular space	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
BMP4	BMP2B \| BMP2B1 \| MCOPS6 \| ZYME	bone morphogenetic protein 4	-	HPRD	7673243
BMP4	BMP2B \| BMP2B1 \| MCOPS6 \| ZYME	bone morphogenetic protein 4	BMP4 forms homo-dimer. This interaction was modeled on a demonstrated interaction using BMP4 from an unspecified species.	BIND	15775969
BMP8B	BMP8 \| MGC131757 \| OP2	bone morphogenetic protein 8b	-	HPRD	10894154 \|11427739
BMPER	CRIM3 \| CV-2 \| CV2	BMP binding endothelial regulator	-	HPRD	12897139
BMPR1A	10q23del \| ACVRLK3 \| ALK3 \| CD292	bone morphogenetic protein receptor, type IA	-	HPRD	8702914 \|11241215
BMPR1A	10q23del \| ACVRLK3 \| ALK3 \| CD292	bone morphogenetic protein receptor, type IA	Reconstituted Complex	BioGRID	8006002
BMPR1B	ALK-6 \| ALK6 \| CDw293	bone morphogenetic protein receptor, type IB	-	HPRD	7811286 \|8702914 \|11282024
BMPR1B	ALK-6 \| ALK6 \| CDw293	bone morphogenetic protein receptor, type IB	Reconstituted Complex	BioGRID	8006002
BMPR1B	ALK-6 \| ALK6 \| CDw293	bone morphogenetic protein receptor, type IB	BMP4 interacts with BMPR1B (BR). This interaction was modeled on a demonstrated interaction between BMP4 from an unspecified species and BMPR1B from an unspecified species.	BIND	15775969
BMPR2	BMPR-II \| BMPR3 \| BMR2 \| BRK-3 \| FLJ41585 \| FLJ76945 \| PPH1 \| T-ALK	bone morphogenetic protein receptor, type II (serine/threonine kinase)	-	HPRD,BioGRID	7644468 \|8702914
CHRD	MGC133038	chordin	BMP4 interacts with an unspecified isoform of CHRD (Chd). This interaction was modeled on a demonstrated interaction between BMP4 from an unspecified species and CHRD from an unspecified species.	BIND	15775969
NOG	SYM1 \| SYNS1	noggin	-	HPRD	10657699
SOSTDC1	CDA019 \| DKFZp564D206 \| ECTODIN \| USAG1	sclerostin domain containing 1	-	HPRD,BioGRID	15020244
STAP2	BKS \| FLJ20234	signal transducing adaptor family member 2	-	HPRD	7644468
TWSG1	TSG	twisted gastrulation homolog 1 (Drosophila)	Reconstituted Complex	BioGRID	11260715

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG HEDGEHOG SIGNALING PATHWAY	56	42	All SZGR 2.0 genes in this pathway
KEGG TGF BETA SIGNALING PATHWAY	86	64	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG BASAL CELL CARCINOMA	55	44	All SZGR 2.0 genes in this pathway
BIOCARTA ALK PATHWAY	37	29	All SZGR 2.0 genes in this pathway
PID BMP PATHWAY	42	31	All SZGR 2.0 genes in this pathway
DAVICIONI MOLECULAR ARMS VS ERMS DN	182	111	All SZGR 2.0 genes in this pathway
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP	255	177	All SZGR 2.0 genes in this pathway
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS BLUE DN	61	35	All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS DN	260	143	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS DN	459	276	All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS F UP	185	119	All SZGR 2.0 genes in this pathway
BEGUM TARGETS OF PAX3 FOXO1 FUSION DN	45	34	All SZGR 2.0 genes in this pathway
SEITZ NEOPLASTIC TRANSFORMATION BY 8P DELETION UP	73	47	All SZGR 2.0 genes in this pathway
DACOSTA ERCC3 ALLELE XPCS VS TTD DN	36	27	All SZGR 2.0 genes in this pathway
GROSS ELK3 TARGETS UP	27	16	All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 UP	209	139	All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 AND HIF1A DN	103	71	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
RANKIN ANGIOGENIC TARGETS OF VHL HIF2A UP	5	5	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN	514	330	All SZGR 2.0 genes in this pathway
BENPORATH MYC TARGETS WITH EBOX	230	156	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP	398	262	All SZGR 2.0 genes in this pathway
FRASOR RESPONSE TO ESTRADIOL DN	82	52	All SZGR 2.0 genes in this pathway
JECHLINGER EPITHELIAL TO MESENCHYMAL TRANSITION DN	66	47	All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS DN	366	238	All SZGR 2.0 genes in this pathway
GUO HEX TARGETS UP	81	54	All SZGR 2.0 genes in this pathway
AFFAR YY1 TARGETS UP	214	133	All SZGR 2.0 genes in this pathway
WEIGEL OXIDATIVE STRESS BY TBH AND H2O2	36	24	All SZGR 2.0 genes in this pathway
WESTON VEGFA TARGETS 6HR	59	38	All SZGR 2.0 genes in this pathway
CHIBA RESPONSE TO TSA UP	52	33	All SZGR 2.0 genes in this pathway
LINDVALL IMMORTALIZED BY TERT UP	78	48	All SZGR 2.0 genes in this pathway
WESTON VEGFA TARGETS	108	71	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 8HR DN	47	31	All SZGR 2.0 genes in this pathway
ZHU CMV 8 HR DN	53	40	All SZGR 2.0 genes in this pathway
ZHU CMV ALL DN	128	93	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 UP	428	266	All SZGR 2.0 genes in this pathway
NIELSEN GIST AND SYNOVIAL SARCOMA UP	20	15	All SZGR 2.0 genes in this pathway
WESTON VEGFA TARGETS 3HR	74	47	All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR DN	191	123	All SZGR 2.0 genes in this pathway
ENGELMANN CANCER PROGENITORS DN	70	44	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER WITH H3K27ME3 DN	228	114	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN	701	446	All SZGR 2.0 genes in this pathway
MATZUK EMBRYONIC GERM CELL	19	16	All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP	871	505	All SZGR 2.0 genes in this pathway
TOOKER GEMCITABINE RESISTANCE UP	79	40	All SZGR 2.0 genes in this pathway
AGUIRRE PANCREATIC CANCER COPY NUMBER UP	298	174	All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS UP	491	316	All SZGR 2.0 genes in this pathway
BOYAULT LIVER CANCER SUBCLASS G6 UP	65	43	All SZGR 2.0 genes in this pathway
CHIANG LIVER CANCER SUBCLASS CTNNB1 UP	176	110	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS DN	306	191	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3	341	243	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 1	68	50	All SZGR 2.0 genes in this pathway
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR DN	88	59	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT	567	365	All SZGR 2.0 genes in this pathway
PASINI SUZ12 TARGETS DN	315	215	All SZGR 2.0 genes in this pathway
KASLER HDAC7 TARGETS 1 UP	194	133	All SZGR 2.0 genes in this pathway
KATSANOU ELAVL1 TARGETS UP	169	105	All SZGR 2.0 genes in this pathway
DELACROIX RAR BOUND ES	462	273	All SZGR 2.0 genes in this pathway
ALFANO MYC TARGETS	239	156	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM B	517	302	All SZGR 2.0 genes in this pathway
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN	308	187	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY	1839	928	All SZGR 2.0 genes in this pathway
ZWANG EGF INTERVAL DN	214	124	All SZGR 2.0 genes in this pathway
NABA SECRETED FACTORS	344	197	All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED	753	411	All SZGR 2.0 genes in this pathway
NABA MATRISOME	1028	559	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-363	194	201	1A,m8	hsa-miR-363	AUUGCACGGUAUCCAUCUGUAA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: BMP4