Gene Page: SOX10

Summary
GeneID  6663
Symbol  SOX10
Synonyms  DOM|MGC15649|WS2E|WS4
Description  SRY (sex determining region Y)-box 10
See related  HGNC:11190|MIM:602229|Ensembl:ENSG00000100146|HPRD:03752|
Locus tag  RP5-1039K5.9
Gene type  protein-coding
Map location  22q13.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
AssociationA combined odds ratio method (Sun et al. 2008), association studies2Link to SZGene
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenic, schizophrenia]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003677DNA bindingIEA-
GO:0003682chromatin bindingIEA-
GO:0003705RNA polymerase II transcription factor activity, enhancer bindingIEA-
GO:0003713transcription coactivator activityTAS9722528 
GO:0042802identical protein bindingIPI11029584 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0048709oligodendrocyte differentiationIEAneuron, axon, oligodendrocyte, Glial (GO term level: 9)-
GO:0048484enteric nervous system developmentIEAneuron (GO term level: 7)-
GO:0001701in utero embryonic developmentIEA-
GO:0006350transcriptionIEA-
GO:0009653anatomical structure morphogenesisTAS9425902 
GO:0048469cell maturationIEA-
GO:0007605sensory perception of soundIEA-
GO:0007422peripheral nervous system developmentIEA-
GO:0030154cell differentiationIEA-
GO:0030318melanocyte differentiationIEA-
GO:0045944positive regulation of transcription from RNA polymerase II promoterIEA-
GO:0048589developmental growthIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005737cytoplasmIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
PAX3CDHS | HUP2 | MGC120381 | MGC120382 | MGC120383 | MGC120384 | MGC134778 | WS1paired box 3Pax3 interacts with Sox10.BIND11029584 
-HPRD,BioGRID10942418 |12668617 
POU3F2BRN2 | OCT7 | OTF7 | POUF3POU class 3 homeobox 2Brn-2 interacts with Sox10.BIND11029584 
SOX10DOM | MGC15649 | WS2E | WS4SRY (sex determining region Y)-box 10Sox10 forms a homodimer.BIND11029584 
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
LEE_NEURAL_CREST_STEM_CELL_UP 14699All SZGR genes in this pathway
SABATES_COLORECTAL_ADENOMA_DN 291176All SZGR genes in this pathway
LIU_CDX2_TARGETS_UP 3622All SZGR genes in this pathway
ODONNELL_METASTASIS_UP 8258All SZGR genes in this pathway
COLIN_PILOCYTIC_ASTROCYTOMA_VS_GLIOBLASTOMA_UP 3532All SZGR genes in this pathway
BENPORATH_SUZ12_TARGETS 1038678All SZGR genes in this pathway
BENPORATH_ES_CORE_NINE_CORRELATED 10068All SZGR genes in this pathway
SHEN_SMARCA2_TARGETS_DN 357212All SZGR genes in this pathway
ASTON_MAJOR_DEPRESSIVE_DISORDER_DN 160110All SZGR genes in this pathway
MODY_HIPPOCAMPUS_POSTNATAL 6350All SZGR genes in this pathway
MCCLUNG_COCAINE_REWARD_5D 7962All SZGR genes in this pathway
BROWNE_HCMV_INFECTION_6HR_UP 7148All SZGR genes in this pathway
LEIN_OLIGODENDROCYTE_MARKERS 7453All SZGR genes in this pathway
MCGOWAN_RSP6_TARGETS_UP 1812All SZGR genes in this pathway
SMID_BREAST_CANCER_RELAPSE_IN_BONE_DN 315197All SZGR genes in this pathway
SMID_BREAST_CANCER_LUMINAL_B_DN 564326All SZGR genes in this pathway
SMID_BREAST_CANCER_ERBB2_DN 55All SZGR genes in this pathway
SMID_BREAST_CANCER_BASAL_UP 648398All SZGR genes in this pathway
ZHANG_BREAST_CANCER_PROGENITORS_DN 14593All SZGR genes in this pathway
YOSHIMURA_MAPK8_TARGETS_UP 1305895All SZGR genes in this pathway
VANTVEER_BREAST_CANCER_ESR1_DN 240153All SZGR genes in this pathway
SHEDDEN_LUNG_CANCER_GOOD_SURVIVAL_A12 317177All SZGR genes in this pathway
VERHAAK_GLIOBLASTOMA_PRONEURAL 177132All SZGR genes in this pathway
CERIBELLI_PROMOTERS_INACTIVE_AND_BOUND_BY_NFY 4420All SZGR genes in this pathway
LIM_MAMMARY_LUMINAL_MATURE_DN 9974All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-155114311491Ahsa-miR-155UUAAUGCUAAUCGUGAUAGGGG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.