Gene Page: LAT2
Summary ?
GeneID | 7462 |
Symbol | LAT2 |
Synonyms | HSPC046|LAB|NTAL|WBSCR15|WBSCR5|WSCR5 |
Description | linker for activation of T-cells family member 2 |
Reference | MIM:605719|HGNC:HGNC:12749|Ensembl:ENSG00000086730|HPRD:09304|Vega:OTTHUMG00000130151 |
Gene type | protein-coding |
Map location | 7q11.23 |
Pascal p-value | 0.176 |
Sherlock p-value | 0.777 |
Fetal beta | -1.266 |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CNV:YES | Copy number variation studies | Manual curation | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs12634640 | chr3 | 186069564 | LAT2 | 7462 | 0.09 | trans | ||
rs17076272 | chr13 | 22726361 | LAT2 | 7462 | 0.08 | trans | ||
rs17076274 | chr13 | 22726381 | LAT2 | 7462 | 0.08 | trans | ||
rs9540668 | chr13 | 66725232 | LAT2 | 7462 | 0.08 | trans | ||
rs2140736 | chr15 | 31159211 | LAT2 | 7462 | 0.17 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IPI | 14722116 | |
GO:0042169 | SH2 domain binding | IMP | 14722116 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0043303 | mast cell degranulation | IEA | serotonin (GO term level: 9) | - |
GO:0007242 | intracellular signaling cascade | IGI | 14722116 | |
GO:0006955 | immune response | IEA | - | |
GO:0019722 | calcium-mediated signaling | IGI | 14722116 | |
GO:0042113 | B cell activation | IDA | 12514734 | |
GO:0042113 | B cell activation | TAS | 14722116 | |
GO:0050853 | B cell receptor signaling pathway | IDA | 12514734 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0016021 | integral to membrane | IEA | - | |
GO:0005886 | plasma membrane | IEA | - | |
GO:0045121 | membrane raft | IDA | 12486104 |12514734 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID FCER1 PATHWAY | 62 | 43 | All SZGR 2.0 genes in this pathway |
ZHONG RESPONSE TO AZACITIDINE AND TSA UP | 183 | 119 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
RHEIN ALL GLUCOCORTICOID THERAPY DN | 362 | 238 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 1 UP | 380 | 236 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC DN | 187 | 115 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 AND HDAC2 TARGETS DN | 232 | 139 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS 12HR DN | 209 | 122 | All SZGR 2.0 genes in this pathway |
MARKEY RB1 ACUTE LOF UP | 215 | 137 | All SZGR 2.0 genes in this pathway |
EBAUER TARGETS OF PAX3 FOXO1 FUSION UP | 207 | 128 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2B | 392 | 251 | All SZGR 2.0 genes in this pathway |
FURUKAWA DUSP6 TARGETS PCI35 DN | 74 | 40 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
KOYAMA SEMA3B TARGETS UP | 292 | 168 | All SZGR 2.0 genes in this pathway |
AMIT EGF RESPONSE 120 HELA | 69 | 47 | All SZGR 2.0 genes in this pathway |
MORI LARGE PRE BII LYMPHOCYTE DN | 58 | 39 | All SZGR 2.0 genes in this pathway |
MORI IMMATURE B LYMPHOCYTE UP | 53 | 35 | All SZGR 2.0 genes in this pathway |
MORI MATURE B LYMPHOCYTE UP | 90 | 62 | All SZGR 2.0 genes in this pathway |
ROSS ACUTE MYELOID LEUKEMIA CBF | 82 | 57 | All SZGR 2.0 genes in this pathway |
ROSS AML WITH AML1 ETO FUSION | 76 | 55 | All SZGR 2.0 genes in this pathway |
SANSOM APC TARGETS DN | 366 | 238 | All SZGR 2.0 genes in this pathway |
XU CREBBP TARGETS DN | 44 | 31 | All SZGR 2.0 genes in this pathway |
BRUNO HEMATOPOIESIS | 66 | 48 | All SZGR 2.0 genes in this pathway |
RAMALHO STEMNESS DN | 74 | 55 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
SAGIV CD24 TARGETS DN | 46 | 26 | All SZGR 2.0 genes in this pathway |
GOLDRATH ANTIGEN RESPONSE | 346 | 192 | All SZGR 2.0 genes in this pathway |
HOFFMANN SMALL PRE BII TO IMMATURE B LYMPHOCYTE UP | 70 | 49 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
VALK AML CLUSTER 13 | 30 | 20 | All SZGR 2.0 genes in this pathway |
POOLA INVASIVE BREAST CANCER UP | 288 | 168 | All SZGR 2.0 genes in this pathway |
LI INDUCED T TO NATURAL KILLER UP | 307 | 182 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE DN | 841 | 431 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP D | 280 | 158 | All SZGR 2.0 genes in this pathway |
HUANG GATA2 TARGETS UP | 149 | 96 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-155 | 513 | 519 | m8 | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.