Gene Page: DCLK1
Summary ?
GeneID | 9201 |
Symbol | DCLK1 |
Synonyms | CL1|CLICK1|DCAMKL1|DCDC3A|DCLK |
Description | doublecortin like kinase 1 |
Reference | MIM:604742|HGNC:HGNC:2700|Ensembl:ENSG00000133083|HPRD:09202|Vega:OTTHUMG00000016729 |
Gene type | protein-coding |
Map location | 13q13 |
Pascal p-value | 0.06 |
Sherlock p-value | 0.629 |
Fetal beta | -2.63 |
eGene | Myers' cis & trans |
Support | INTRACELLULAR SIGNAL TRANSDUCTION G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 6 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg12942606 | 13 | 36429952 | MIR548F5;DCLK1 | 1.269E-4 | 0.577 | 0.03 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs2494067 | chr1 | 108245614 | DCLK1 | 9201 | 0.15 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0005057 | receptor signaling protein activity | TAS | 10036192 | |
GO:0005515 | protein binding | NAS | 14613930 | |
GO:0005524 | ATP binding | IEA | - | |
GO:0004674 | protein serine/threonine kinase activity | IEA | - | |
GO:0016740 | transferase activity | IEA | - | |
GO:0016301 | kinase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007417 | central nervous system development | TAS | Brain (GO term level: 6) | 10051403 |
GO:0001764 | neuron migration | IEA | neuron (GO term level: 8) | - |
GO:0048675 | axon extension | IEA | axon (GO term level: 13) | - |
GO:0030900 | forebrain development | IEA | Brain (GO term level: 8) | - |
GO:0021952 | central nervous system projection neuron axonogenesis | IEA | neuron, axon (GO term level: 14) | - |
GO:0048813 | dendrite morphogenesis | IEA | neurite, dendrite (GO term level: 12) | - |
GO:0006468 | protein amino acid phosphorylation | TAS | 9747029 | |
GO:0007242 | intracellular signaling cascade | IEA | - | |
GO:0007275 | multicellular organismal development | IEA | - | |
GO:0016197 | endosome transport | NAS | 14613930 | |
GO:0030154 | cell differentiation | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005887 | integral to plasma membrane | TAS | 10036192 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PICCALUGA ANGIOIMMUNOBLASTIC LYMPHOMA UP | 205 | 140 | All SZGR 2.0 genes in this pathway |
TURASHVILI BREAST DUCTAL CARCINOMA VS DUCTAL NORMAL UP | 44 | 25 | All SZGR 2.0 genes in this pathway |
DOANE RESPONSE TO ANDROGEN DN | 241 | 146 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 TARGETS UP | 457 | 269 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 AND HDAC2 TARGETS UP | 238 | 144 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION DN | 329 | 219 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
PACHER TARGETS OF IGF1 AND IGF2 UP | 35 | 27 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
KIM MYC AMPLIFICATION TARGETS DN | 97 | 51 | All SZGR 2.0 genes in this pathway |
RICKMAN HEAD AND NECK CANCER F | 54 | 32 | All SZGR 2.0 genes in this pathway |
BENPORATH ES 1 | 379 | 235 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
STARK HYPPOCAMPUS 22Q11 DELETION UP | 53 | 40 | All SZGR 2.0 genes in this pathway |
AMIT EGF RESPONSE 480 HELA | 164 | 118 | All SZGR 2.0 genes in this pathway |
LEE TARGETS OF PTCH1 AND SUFU DN | 83 | 69 | All SZGR 2.0 genes in this pathway |
GOTTWEIN TARGETS OF KSHV MIR K12 11 | 63 | 45 | All SZGR 2.0 genes in this pathway |
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD UP | 131 | 87 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 16HR DN | 86 | 62 | All SZGR 2.0 genes in this pathway |
KUNINGER IGF1 VS PDGFB TARGETS UP | 82 | 51 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 UP | 428 | 266 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
FINETTI BREAST CANCERS KINOME BLUE | 21 | 16 | All SZGR 2.0 genes in this pathway |
IWANAGA CARCINOGENESIS BY KRAS PTEN DN | 353 | 226 | All SZGR 2.0 genes in this pathway |
RIZKI TUMOR INVASIVENESS 3D UP | 210 | 124 | All SZGR 2.0 genes in this pathway |
DAIRKEE CANCER PRONE RESPONSE BPA E2 | 118 | 65 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER RELAPSE IN BONE UP | 97 | 61 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
GRADE COLON VS RECTAL CANCER DN | 56 | 36 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL UP | 260 | 174 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL CULTURED VS FRESH UP | 425 | 298 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS DN | 366 | 257 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
CROONQUIST NRAS VS STROMAL STIMULATION DN | 99 | 65 | All SZGR 2.0 genes in this pathway |
FONTAINE FOLLICULAR THYROID ADENOMA DN | 68 | 45 | All SZGR 2.0 genes in this pathway |
FONTAINE PAPILLARY THYROID CARCINOMA DN | 80 | 53 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
HOELZEL NF1 TARGETS UP | 139 | 93 | All SZGR 2.0 genes in this pathway |
DEMAGALHAES AGING UP | 55 | 39 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 24HR DN | 505 | 328 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
SERVITJA ISLET HNF1A TARGETS UP | 163 | 111 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 TARGETS 10HR DN | 244 | 157 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-137 | 970 | 976 | 1A | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
miR-15/16/195/424/497 | 309 | 316 | 1A,m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG | ||||
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
miR-216 | 152 | 158 | m8 | hsa-miR-216 | UAAUCUCAGCUGGCAACUGUG |
miR-217 | 403 | 409 | 1A | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU |
miR-328 | 1401 | 1407 | 1A | hsa-miR-328brain | CUGGCCCUCUCUGCCCUUCCGU |
miR-330 | 1144 | 1150 | m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
miR-383 | 191 | 197 | m8 | hsa-miR-383brain | AGAUCAGAAGGUGAUUGUGGCU |
miR-503 | 310 | 316 | 1A | hsa-miR-503 | UAGCAGCGGGAACAGUUCUGCAG |
hsa-miR-503 | UAGCAGCGGGAACAGUUCUGCAG | ||||
miR-539 | 1040 | 1046 | 1A | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.