SZGR2

Summary ?

GeneID	9378
Symbol	NRXN1
Synonyms	Hs.22998\|PTHSL2\|SCZD17
Description	neurexin 1
Reference	MIM:600565\|HGNC:HGNC:8008\|Ensembl:ENSG00000179915\|HPRD:11858\|Vega:OTTHUMG00000129263
Gene type	protein-coding
Map location	2p16.3
Sherlock p-value	0.535
TADA p-value	0.025
Fetal beta	1.407
DMG	1 (# studies)
eGene	Myers' cis & trans
Support	CELL ADHESION AND TRANSSYNAPTIC SIGNALING G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CNV:YES	Copy number variation studies	Manual curation
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
DNM:Awadalla_2010	Whole Exome Sequencing analysis	A survey of ~430 Mb of DNA from 401 synapse-expressed genes across all cases and 25 Mb of DNA in controls found 28 candidate DNMs.
DNM:Fromer_2014	Whole Exome Sequencing analysis	This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
NRXN1	chr2	50724807	T	C	NM_001135659 NM_004801	p.888E>G p.848E>G	missense missense			Schizophrenia	DNM:Fromer_2014
NRXN1	chr2	50149317	-	ACGG	NRXN1:NM_138735:exon6:c.1093_1094insCCGT:p.T365fs NRXN1:NM_004801:exon22:c.4198_4199insCCGT:p.T1400fs NRXN1:NM_001135659:exon24:c.4408_4409insCCGT:p.T1470fs	G1402DfsX29	frameshift insertion			Schizophrenia	DNM:Awadalla_2010

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg22324022	2	51259703	NRXN1	2.157E-4	0.325	0.036	DMG:Wockner_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs5909851	chrX	121070531	NRXN1	9378		0.06		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
PSMA1	0.90	0.87
MRPS35	0.89	0.85
OLA1	0.88	0.86
ORC5L	0.87	0.85
STRAP	0.87	0.84
COPS3	0.86	0.82
SKP1	0.86	0.84
COPS4	0.86	0.85
AZI2	0.85	0.83
PMPCB	0.85	0.80

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.2	-0.69	-0.59
AF347015.26	-0.68	-0.60
AF347015.8	-0.67	-0.57
AF347015.15	-0.65	-0.56
MT-CYB	-0.65	-0.56
MT-CO2	-0.65	-0.54
AF347015.18	-0.64	-0.63
AF347015.33	-0.64	-0.56
AF347015.31	-0.60	-0.52
AF347015.27	-0.60	-0.53

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004872	receptor activity	TAS		1621094
GO:0005509	calcium ion binding	IEA		-
GO:0005515	protein binding	IEA		-
GO:0005515	protein binding	IPI		11152476
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007411	axon guidance	TAS	axon (GO term level: 13)	1621094
GO:0007155	cell adhesion	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	IEA		-
GO:0005887	integral to plasma membrane	TAS		1621094

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
APBA1	D9S411E \| MINT1 \| X11 \| X11A \| X11ALPHA	amyloid beta (A4) precursor protein-binding, family A, member 1	-	HPRD,BioGRID	11036064
APBA2	D15S1518E \| HsT16821 \| LIN-10 \| MGC99508 \| MGC:14091 \| MINT2 \| X11L	amyloid beta (A4) precursor protein-binding, family A, member 2	-	HPRD,BioGRID	11036064
CASK	CAGH39 \| CMG \| FLJ22219 \| FLJ31914 \| LIN2 \| MICPCH \| TNRC8	calcium/calmodulin-dependent serine protein kinase (MAGUK family)	-	HPRD,BioGRID	11036064
CASK	CAGH39 \| CMG \| FLJ22219 \| FLJ31914 \| LIN2 \| MICPCH \| TNRC8	calcium/calmodulin-dependent serine protein kinase (MAGUK family)	-	HPRD	8786425
MACF1	ABP620 \| ACF7 \| FLJ45612 \| FLJ46776 \| KIAA0465 \| KIAA1251 \| MACF \| OFC4	microtubule-actin crosslinking factor 1	-	HPRD	12421765
MLLT4	AF-6 \| AF6 \| AFADIN \| FLJ34371 \| RP3-431P23.3	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	Two-hybrid	BioGRID	9707552
MYO16	KIAA0865 \| MYR8 \| Myo16b	myosin XVI	-	HPRD	12421765
NLGN1	KIAA1070 \| MGC45115	neuroligin 1	-	HPRD,BioGRID	8576240 \|14522992
NLGN2	KIAA1366	neuroligin 2	-	HPRD,BioGRID	8576240
NLGN3	ASPGX1 \| AUTSX1 \| HNL3 \| KIAA1480	neuroligin 3	-	HPRD	8576240 \|9325340
NLGN3	ASPGX1 \| AUTSX1 \| HNL3 \| KIAA1480	neuroligin 3	-	HPRD,BioGRID	8576240
NXPH1	NPH1 \| Nbla00697	neurexophilin 1	-	HPRD	8699246
NXPH1	NPH1 \| Nbla00697	neurexophilin 1	-	HPRD	9856994
NXPH2	MGC125477 \| MGC125478 \| MGC125479 \| MGC125480 \| NPH2	neurexophilin 2	-	HPRD	8699246
NXPH3	NPH3	neurexophilin 3	-	HPRD	9856994
PDZD2	AIPC \| KIAA0300 \| PAPIN \| PDZK3 \| PIN1	PDZ domain containing 2	-	HPRD	12421765
RPH3A	KIAA0985	rabphilin 3A homolog (mouse)	-	HPRD	8901523
SDCBP	MDA-9 \| ST1 \| SYCL \| TACIP18	syndecan binding protein (syntenin)	Neurexin I-alpha interacts with ST-1. This interaction was modelled on a demonstrated interaction between human neurexin I-alpha and rat ST-1.	BIND	11152476
SDCBP2	FLJ12256 \| SITAC18 \| ST-2	syndecan binding protein (syntenin) 2	-	HPRD	11152476
SIPA1L1	DKFZp686G1344 \| E6TP1 \| KIAA0440	signal-induced proliferation-associated 1 like 1	-	HPRD	12421765
SYT1	DKFZp781D2042 \| P65 \| SVP65 \| SYT	synaptotagmin I	-	HPRD	8901523 \|11243866
SYT13	KIAA1427	synaptotagmin XIII	-	HPRD,BioGRID	11171101
SYT2	SytII	synaptotagmin II	-	HPRD	8901523
SYT4	HsT1192 \| KIAA1342	synaptotagmin IV	-	HPRD	8901523
SYT5	-	synaptotagmin V	-	HPRD	8901523
SYT6	-	synaptotagmin VI	-	HPRD	8901523
SYT7	IPCA-7 \| MGC150517 \| PCANAP7 \| SYT-VII	synaptotagmin VII	-	HPRD	8901523
SYT9	FLJ45896	synaptotagmin IX	-	HPRD	8901523
SYTL1	FLJ14996 \| JFC1 \| SLP1	synaptotagmin-like 1	-	HPRD	11243866
SYTL2	CHR11SYT \| KIAA1597 \| MGC102768 \| SGA72M \| SLP2	synaptotagmin-like 2	-	HPRD	11243866
SYTL3	MGC105130 \| MGC118883 \| MGC118884 \| MGC118885 \| SLP3	synaptotagmin-like 3	-	HPRD	11243866

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CELL ADHESION MOLECULES CAMS	134	93	All SZGR 2.0 genes in this pathway
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 UP	408	247	All SZGR 2.0 genes in this pathway
LEE NEURAL CREST STEM CELL UP	146	99	All SZGR 2.0 genes in this pathway
SABATES COLORECTAL ADENOMA DN	291	176	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS B UP	26	16	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
LU AGING BRAIN DN	153	120	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL	254	164	All SZGR 2.0 genes in this pathway
NIELSEN SCHWANNOMA UP	18	16	All SZGR 2.0 genes in this pathway
HELLER SILENCED BY METHYLATION UP	282	183	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS SILENCED BY METHYLATION UP	461	298	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER NORMAL LIKE UP	476	285	All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR DN	546	362	All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3	718	401	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC ICP WITH H3K4ME3	445	257	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP	548	370	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL	177	132	All SZGR 2.0 genes in this pathway
HOELZEL NF1 TARGETS UP	139	93	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B	549	316	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY	1725	838	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-103/107	1528	1534	1A	hsa-miR-103^brain	AGCAGCAUUGUACAGGGCUAUGA
miR-103/107	1528	1534	1A	hsa-miR-107^brain	AGCAGCAUUGUACAGGGCUAUCA
miR-128	779	785	1A	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	779	785	1A	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-129-5p	188	194	1A	hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
				hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
				hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
				hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
miR-141/200a	230	236	m8	hsa-miR-141	UAACACUGUCUGGUAAAGAUGG
miR-141/200a	230	236	m8	hsa-miR-200a	UAACACUGUCUGGUAACGAUGU
miR-181	1022	1029	1A,m8	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-196	377	383	1A	hsa-miR-196a	UAGGUAGUUUCAUGUUGUUGG
miR-196	377	383	1A	hsa-miR-196b	UAGGUAGUUUCCUGUUGUUGG
miR-218	88	94	m8	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-23	636	643	1A,m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	636	643	1A,m8	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-27	779	785	m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	779	785	m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-323	636	642	1A	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-326	438	444	1A	hsa-miR-326	CCUCUGGGCCCUUCCUCCAG
miR-328	205	211	1A	hsa-miR-328^brain	CUGGCCCUCUCUGCCCUUCCGU
miR-33	817	823	1A	hsa-miR-33	GUGCAUUGUAGUUGCAUUG
miR-33	817	823	1A	hsa-miR-33b	GUGCAUUGCUGUUGCAUUGCA
miR-335	163	169	m8	hsa-miR-335^brain	UCAAGAGCAAUAACGAAAAAUGU
miR-339	105	112	1A,m8	hsa-miR-339	UCCCUGUCCUCCAGGAGCUCA
miR-377	1111	1117	1A	hsa-miR-377	AUCACACAAAGGCAACUUUUGU
miR-381	22	29	1A,m8	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-381	22	29	1A,m8	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-410	747	753	1A	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-455	90	96	1A	hsa-miR-455	UAUGUGCCUUUGGACUACAUCG
miR-485-3p	1018	1025	1A,m8	hsa-miR-485-3p	GUCAUACACGGCUCUCCUCUCU
miR-485-3p	1018	1025	1A,m8	hsa-miR-485-3p	GUCAUACACGGCUCUCCUCUCU
miR-96	1326	1332	m8	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: NRXN1