Gene Page: PITPNM1
Summary ?
| GeneID | 9600 |
| Symbol | PITPNM1 |
| Synonyms | DRES9|NIR2|PITPNM|RDGB|RDGB1|RDGBA|RDGBA1|Rd9 |
| Description | phosphatidylinositol transfer protein membrane associated 1 |
| Reference | MIM:608794|HGNC:HGNC:9003|Ensembl:ENSG00000110697|HPRD:07497|Vega:OTTHUMG00000167675 |
| Gene type | protein-coding |
| Map location | 11q13 |
| Pascal p-value | 0.345 |
| Sherlock p-value | 0.948 |
| Fetal beta | -0.616 |
| DMG | 1 (# studies) |
| Support | G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS CompositeSet Darnell FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
| DNM:McCarthy_2014 | Whole Exome Sequencing analysis | Whole exome sequencing of 57 trios with sporadic or familial schizophrenia. | |
| DNM:Xu_2012 | Whole Exome Sequencing analysis | De novo mutations of 4 genes were identified by exome sequencing of 795 samples in this study | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| PITPNM1 | chr11 | 67267698 | C | T | NM_001130848 | p.R279W | missense SNV | C | D | Schizophrenia | DNM:McCarthy_2014 |
| PITPNM1 | chr11 | 67267884 | G | A | NM_001130848 NM_004910 | p.217R>W p.217R>W | missense missense | Schizophrenia | DNM:Xu_2012 |
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg17616646 | 11 | 67271660 | PITPNM1 | 1.487E-4 | 0.63 | 0.032 | DMG:Wockner_2014 |
| cg17086579 | 11 | 67266089 | PITPNM1 | 4.92E-4 | 0.511 | 0.047 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| DUSP15 | 0.74 | 0.64 |
| C6orf108 | 0.68 | 0.52 |
| PLCB2 | 0.64 | 0.42 |
| HLA-DPB2 | 0.63 | 0.30 |
| CCDC96 | 0.61 | 0.13 |
| C14orf179 | 0.61 | 0.54 |
| SLC16A8 | 0.61 | 0.52 |
| EXOC3L | 0.60 | 0.44 |
| F12 | 0.60 | 0.49 |
| DDC | 0.60 | 0.23 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| KCNJ3 | -0.39 | -0.47 |
| CDH18 | -0.38 | -0.49 |
| ANKRD56 | -0.38 | -0.43 |
| OSBPL3 | -0.37 | -0.52 |
| ELL2 | -0.37 | -0.48 |
| SH3GL2 | -0.36 | -0.45 |
| FBXW7 | -0.36 | -0.39 |
| CAP2 | -0.36 | -0.45 |
| C6orf142 | -0.35 | -0.46 |
| SORL1 | -0.35 | -0.46 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005509 | calcium ion binding | IEA | - | |
| GO:0008526 | phosphatidylinositol transporter activity | TAS | 9245688 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007420 | brain development | TAS | Brain (GO term level: 7) | 9245688 |
| GO:0007602 | phototransduction | TAS | 9680295 | |
| GO:0006629 | lipid metabolic process | NAS | 9680295 | |
| GO:0015031 | protein transport | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005794 | Golgi apparatus | IEA | - | |
| GO:0005789 | endoplasmic reticulum membrane | IEA | - | |
| GO:0005622 | intracellular | IEA | - | |
| GO:0005624 | membrane fraction | TAS | 9245688 | |
| GO:0005737 | cytoplasm | IEA | - | |
| GO:0005783 | endoplasmic reticulum | IEA | - | |
| GO:0016020 | membrane | IEA | - | |
| GO:0012511 | monolayer-surrounded lipid storage body | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP | 612 | 367 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER SERUM RESPONSE UP | 134 | 93 | All SZGR 2.0 genes in this pathway |
| DAIRKEE TERT TARGETS UP | 380 | 213 | All SZGR 2.0 genes in this pathway |
| SHETH LIVER CANCER VS TXNIP LOSS PAM1 | 229 | 137 | All SZGR 2.0 genes in this pathway |
| SHETH LIVER CANCER VS TXNIP LOSS PAM6 | 46 | 32 | All SZGR 2.0 genes in this pathway |
| LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
| NIKOLSKY BREAST CANCER 11Q12 Q14 AMPLICON | 158 | 93 | All SZGR 2.0 genes in this pathway |
| THEILGAARD NEUTROPHIL AT SKIN WOUND DN | 225 | 163 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 2 | 473 | 224 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY E2F4 UNSTIMULATED | 728 | 415 | All SZGR 2.0 genes in this pathway |
| MASSARWEH TAMOXIFEN RESISTANCE UP | 578 | 341 | All SZGR 2.0 genes in this pathway |
| GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
| ZHANG TLX TARGETS 60HR UP | 293 | 203 | All SZGR 2.0 genes in this pathway |
| CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP | 271 | 165 | All SZGR 2.0 genes in this pathway |
| VANLOO SP3 TARGETS DN | 89 | 47 | All SZGR 2.0 genes in this pathway |
| WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 36HR | 152 | 88 | All SZGR 2.0 genes in this pathway |
| WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D | 882 | 506 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-491 | 113 | 119 | 1A | hsa-miR-491brain | AGUGGGGAACCCUUCCAUGAGGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.