Gene Page: DNAJC6
Summary ?
| GeneID | 9829 |
| Symbol | DNAJC6 |
| Synonyms | DJC6|PARK19 |
| Description | DnaJ heat shock protein family (Hsp40) member C6 |
| Reference | MIM:608375|HGNC:HGNC:15469|Ensembl:ENSG00000116675|HPRD:16326|Vega:OTTHUMG00000009066 |
| Gene type | protein-coding |
| Map location | 1p31.3 |
| Pascal p-value | 0.891 |
| Fetal beta | -1.004 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans |
| Support | RNA AND PROTEIN SYNTHESIS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
| DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02692 |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| DNAJC6 | chr1 | 65858354 | C | T | NM_001256864 NM_001256865 NM_014787 | p.570P>L p.500P>L p.513P>L | missense missense missense | Schizophrenia | DNM:Fromer_2014 |
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg07027116 | 1 | 65731738 | DNAJC6 | 3.57E-9 | -0.016 | 2.32E-6 | DMG:Jaffe_2016 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs6902872 | chr6 | 135087022 | DNAJC6 | 9829 | 0.18 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| STX10 | 0.84 | 0.76 |
| C1orf35 | 0.82 | 0.73 |
| QTRT1 | 0.82 | 0.76 |
| ZBTB48 | 0.82 | 0.76 |
| RP3-402G11.1 | 0.80 | 0.72 |
| RHOT2 | 0.80 | 0.77 |
| FAM113A | 0.80 | 0.70 |
| WDR85 | 0.80 | 0.72 |
| TRMT1 | 0.79 | 0.73 |
| ZGPAT | 0.79 | 0.75 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.31 | -0.50 | -0.49 |
| AF347015.27 | -0.49 | -0.50 |
| MT-CO2 | -0.48 | -0.48 |
| MT-CYB | -0.48 | -0.48 |
| AF347015.21 | -0.48 | -0.53 |
| AF347015.33 | -0.47 | -0.47 |
| AF347015.8 | -0.46 | -0.46 |
| TM4SF18 | -0.44 | -0.45 |
| AF347015.9 | -0.44 | -0.48 |
| AF347015.15 | -0.44 | -0.46 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004725 | protein tyrosine phosphatase activity | IEA | - | |
| GO:0016787 | hydrolase activity | IEA | - | |
| GO:0017124 | SH3 domain binding | IEA | - | |
| GO:0031072 | heat shock protein binding | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG ENDOCYTOSIS | 183 | 132 | All SZGR 2.0 genes in this pathway |
| REACTOME MEMBRANE TRAFFICKING | 129 | 74 | All SZGR 2.0 genes in this pathway |
| REACTOME TRANS GOLGI NETWORK VESICLE BUDDING | 60 | 31 | All SZGR 2.0 genes in this pathway |
| REACTOME LYSOSOME VESICLE BIOGENESIS | 23 | 11 | All SZGR 2.0 genes in this pathway |
| REACTOME GOLGI ASSOCIATED VESICLE BIOGENESIS | 53 | 27 | All SZGR 2.0 genes in this pathway |
| SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 DN | 175 | 82 | All SZGR 2.0 genes in this pathway |
| CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
| VECCHI GASTRIC CANCER EARLY DN | 367 | 220 | All SZGR 2.0 genes in this pathway |
| TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D UP | 157 | 91 | All SZGR 2.0 genes in this pathway |
| TAKEDA TARGETS OF NUP98 HOXA9 FUSION 10D UP | 194 | 122 | All SZGR 2.0 genes in this pathway |
| CHEBOTAEV GR TARGETS DN | 120 | 73 | All SZGR 2.0 genes in this pathway |
| LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
| PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
| DAIRKEE TERT TARGETS DN | 124 | 79 | All SZGR 2.0 genes in this pathway |
| LIAO METASTASIS | 539 | 324 | All SZGR 2.0 genes in this pathway |
| BENPORATH CYCLING GENES | 648 | 385 | All SZGR 2.0 genes in this pathway |
| ROSS AML OF FAB M7 TYPE | 68 | 44 | All SZGR 2.0 genes in this pathway |
| OKUMURA INFLAMMATORY RESPONSE LPS | 183 | 115 | All SZGR 2.0 genes in this pathway |
| HADDAD T LYMPHOCYTE AND NK PROGENITOR UP | 78 | 56 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 1 | 419 | 273 | All SZGR 2.0 genes in this pathway |
| BILD HRAS ONCOGENIC SIGNATURE | 261 | 166 | All SZGR 2.0 genes in this pathway |
| LEIN LOCALIZED TO PROXIMAL DENDRITES | 37 | 26 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
| WEST ADRENOCORTICAL TUMOR UP | 294 | 199 | All SZGR 2.0 genes in this pathway |
| HAN SATB1 TARGETS DN | 442 | 275 | All SZGR 2.0 genes in this pathway |
| VALK AML CLUSTER 7 | 28 | 16 | All SZGR 2.0 genes in this pathway |
| BOYAULT LIVER CANCER SUBCLASS G23 UP | 52 | 35 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
| WHITFIELD CELL CYCLE S | 162 | 86 | All SZGR 2.0 genes in this pathway |
| PASINI SUZ12 TARGETS UP | 112 | 65 | All SZGR 2.0 genes in this pathway |
| MADAN DPPA4 TARGETS | 46 | 26 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-219 | 1462 | 1469 | 1A,m8 | hsa-miR-219brain | UGAUUGUCCAAACGCAAUUCU |
| miR-23 | 1763 | 1769 | m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
| hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
| miR-323 | 1763 | 1769 | 1A | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
| miR-342 | 1765 | 1771 | 1A | hsa-miR-342brain | UCUCACACAGAAAUCGCACCCGUC |
| miR-369-3p | 1711 | 1718 | 1A,m8 | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
| miR-377 | 1819 | 1826 | 1A,m8 | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.