SZGR2

Summary ?

GeneID	10048
Symbol	RANBP9
Synonyms	BPM-L\|BPM90\|RANBPM\|RanBP7
Description	RAN binding protein 9
Reference	MIM:603854\|HGNC:HGNC:13727\|Ensembl:ENSG00000010017\|HPRD:04835\|Vega:OTTHUMG00000015642
Gene type	protein-coding
Map location	6p23
Pascal p-value	0.012
Sherlock p-value	4.646E-5
Fetal beta	-0.348

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I	Genome scan meta-analysis	Psr: 0.0159
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0833

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MAP3K1	0.78	0.62
AP001979.1	0.77	0.66
TSPAN9	0.77	0.64
SPATA13	0.77	0.67
ZNF503	0.76	0.64
TRERF1	0.76	0.77
FOXP4	0.75	0.66
RARA	0.75	0.67
MEIS1	0.75	0.63
AC010997.1	0.75	0.59

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.21	-0.45	-0.47
C1orf54	-0.42	-0.48
SYCP3	-0.41	-0.49
AF347015.31	-0.40	-0.41
MT-CO2	-0.40	-0.40
VAMP5	-0.39	-0.40
GNG11	-0.38	-0.42
HIGD1B	-0.37	-0.36
CLEC2B	-0.37	-0.42
IL32	-0.37	-0.45

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IPI		12220523 \|12421467 \|14500717
GO:0008536	Ran GTPase binding	TAS		9817760
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006461	protein complex assembly	TAS		9817760
GO:0007020	microtubule nucleation	NAS		12220523
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005875	microtubule associated complex	TAS		9817760
GO:0005634	nucleus	IDA		12220523
GO:0005737	cytoplasm	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AR	AIS \| DHTR \| HUMARA \| KD \| NR3C4 \| SBMA \| SMAX1 \| TFM	androgen receptor	-	HPRD,BioGRID	12361945
AXL	JTK11 \| UFO	AXL receptor tyrosine kinase	Axl interacts with RanBPM.	BIND	12470648
BACE1	ASP2 \| BACE \| FLJ90568 \| HSPC104 \| KIAA1149	beta-site APP-cleaving enzyme 1	BACE1 interacts with RANBP9 (RANBPM). This interaction was modelled on a demonstrated interaction between mouse BACE1 and human RANBPM.	BIND	15606899
CALB1	CALB	calbindin 1, 28kDa	-	HPRD,BioGRID	12684061
DISC1	C1orf136 \| FLJ13381 \| FLJ21640 \| FLJ25311 \| FLJ41105 \| KIAA0457 \| SCZD9	disrupted in schizophrenia 1	-	HPRD,BioGRID	12812986
DISC1	C1orf136 \| FLJ13381 \| FLJ21640 \| FLJ25311 \| FLJ41105 \| KIAA0457 \| SCZD9	disrupted in schizophrenia 1	DISC-1 interacts with RanBPM.	BIND	12812986
DYRK1B	MIRK	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B	-	HPRD,BioGRID	14500717
FMR1	FMRP \| FRAXA \| MGC87458 \| POF \| POF1	fragile X mental retardation 1	FMR1 (FMRP) interacts with RANBP9 (RanBPM).	BIND	15381419
HIPK2	DKFZp686K02111 \| FLJ23711 \| PRO0593	homeodomain interacting protein kinase 2	The nuclear protein kinase HIPK2 interacts with the Ran binding protein RanBPM	BIND	12220523
HIPK2	DKFZp686K02111 \| FLJ23711 \| PRO0593	homeodomain interacting protein kinase 2	-	HPRD,BioGRID	12220523
ITGB2	CD18 \| LAD \| LCAMB \| LFA-1 \| MAC-1 \| MF17 \| MFI7	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	RanBPM interacts with beta-2 integrin LFA-1.	BIND	14722085
L1CAM	CAML1 \| CD171 \| HSAS \| HSAS1 \| MASA \| MIC5 \| N-CAML1 \| S10 \| SPG1	L1 cell adhesion molecule	L1CAM interacts with RanBPM.	BIND	16000162
MET	AUTS9 \| HGFR \| RCCP2 \| c-Met	met proto-oncogene (hepatocyte growth factor receptor)	-	HPRD,BioGRID	12147692
MPHOSPH8	FLJ35237 \| HSMPP8 \| TWA3 \| mpp8	M-phase phosphoprotein 8	-	HPRD,BioGRID	12559565
NR3C1	GCCR \| GCR \| GR \| GRL	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	Affinity Capture-Western Two-hybrid	BioGRID	12361945
RAN	ARA24 \| Gsp1 \| TC4	RAN, member RAS oncogene family	-	HPRD,BioGRID	9817760
RNPS1	E5.1 \| MGC117332	RNA binding protein S1, serine-rich domain	Affinity Capture-MS	BioGRID	17353931
S100A7	PSOR1 \| S100A7c	S100 calcium binding protein A7	-	HPRD,BioGRID	12421467
UCHL1	PARK5 \| PGP9.5 \| Uch-L1	ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)	-	HPRD,BioGRID	12082530
USP11	UHX1	ubiquitin specific peptidase 11	-	HPRD,BioGRID	12084015

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID MET PATHWAY	80	60	All SZGR 2.0 genes in this pathway
PID AR PATHWAY	61	46	All SZGR 2.0 genes in this pathway
REACTOME DEVELOPMENTAL BIOLOGY	396	292	All SZGR 2.0 genes in this pathway
REACTOME AXON GUIDANCE	251	188	All SZGR 2.0 genes in this pathway
REACTOME L1CAM INTERACTIONS	86	62	All SZGR 2.0 genes in this pathway
PARENT MTOR SIGNALING UP	567	375	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
DITTMER PTHLH TARGETS UP	112	68	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 24HR DN	214	133	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP	1278	748	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK	779	480	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
DEN INTERACT WITH LCA5	26	21	All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 6P24 P22 AMPLICON	21	17	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL AND BRAIN QTL TRANS	185	114	All SZGR 2.0 genes in this pathway
PENG GLUTAMINE DEPRIVATION DN	337	230	All SZGR 2.0 genes in this pathway
LU AGING BRAIN DN	153	120	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
JIANG VHL TARGETS	138	91	All SZGR 2.0 genes in this pathway
JI RESPONSE TO FSH DN	58	43	All SZGR 2.0 genes in this pathway
DURCHDEWALD SKIN CARCINOGENESIS DN	264	168	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 2	473	224	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP	673	430	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP	602	364	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP	601	369	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 4HR UP	55	41	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 2 DN	336	211	All SZGR 2.0 genes in this pathway
ABRAMSON INTERACT WITH AIRE	45	33	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-101	507	514	1A,m8	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-144	508	514	1A	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-200bc/429	681	688	1A,m8	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-208	753	759	1A	hsa-miR-208	AUAAGACGAGCAAAAAGCUUGU
miR-214	64	70	1A	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG
miR-25/32/92/363/367	810	816	1A	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-26	517	523	1A	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	517	523	1A	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-30-5p	137	143	1A	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-323	501	507	m8	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-410	718	724	1A	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-411	748	754	m8	hsa-miR-411	AACACGGUCCACUAACCCUCAGU
miR-496	375	381	1A	hsa-miR-496	AUUACAUGGCCAAUCUC
miR-499	753	759	1A	hsa-miR-499	UUAAGACUUGCAGUGAUGUUUAA
miR-505	478	484	m8	hsa-miR-505	GUCAACACUUGCUGGUUUCCUC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: RANBP9