SZGR2

Summary ?

GeneID	10492
Symbol	SYNCRIP
Synonyms	GRY-RBP\|GRYRBP\|HNRNPQ\|HNRPQ1\|NSAP1\|PP68\|hnRNP-Q
Description	synaptotagmin binding, cytoplasmic RNA interacting protein
Reference	MIM:616686\|HGNC:HGNC:16918\|Ensembl:ENSG00000135316\|HPRD:06734\|Vega:OTTHUMG00000015141
Gene type	protein-coding
Map location	6q14-q15
Pascal p-value	1.459E-4
Sherlock p-value	0.467
eGene	Cerebellar Hemisphere

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0003723	RNA binding	TAS		9847309
GO:0005515	protein binding	IPI		12674497 \|17353931
GO:0008143	poly(A) binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006397	mRNA processing	IEA		-
GO:0008380	RNA splicing	TAS		9847309
GO:0044419	interspecies interaction between organisms	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005792	microsome	IEA		-
GO:0005634	nucleus	TAS		9847309
GO:0005681	spliceosome	IEA		-
GO:0005737	cytoplasm	IEA		-
GO:0005783	endoplasmic reticulum	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
A1CF	ACF \| ACF64 \| ACF65 \| APOBEC1CF \| ASP \| MGC163391 \| RP11-564C4.2	APOBEC1 complementation factor	-	HPRD,BioGRID	11134005 \|11352648
APOBEC1	APOBEC-1 \| BEDP \| CDAR1 \| HEPR	apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1	Reconstituted Complex Two-hybrid	BioGRID	11352648
CNBP	CNBP1 \| DM2 \| FLJ11631 \| PROMM \| RNF163 \| ZCCHC22 \| ZNF9	CCHC-type zinc finger, nucleic acid binding protein	Affinity Capture-MS	BioGRID	17353931
EPRS	DKFZp313B047 \| EARS \| GLUPRORS \| PARS \| PIG32 \| QARS \| QPRS	glutamyl-prolyl-tRNA synthetase	NSAP-1 interacts with GluProRS.	BIND	15479637
GAPDH	G3PD \| GAPD \| MGC88685	glyceraldehyde-3-phosphate dehydrogenase	NSAP-1 interacts with GAPDH.	BIND	15479637
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	Reconstituted Complex	BioGRID	9341187
HNRNPAB	ABBP1 \| FLJ40338 \| HNRPAB	heterogeneous nuclear ribonucleoprotein A/B	-	HPRD	11352648
INSR	CD220 \| HHF5	insulin receptor	-	HPRD,BioGRID	11994298
MGC34774	-	ribosomal protein L13A pseudogene	NSAP-1 interacts with L13a.	BIND	15479637
PLCG1	PLC-II \| PLC1 \| PLC148 \| PLCgamma1	phospholipase C, gamma 1	Reconstituted Complex	BioGRID	9341187
PRKRA	DYT16 \| HSD14 \| PACT \| RAX	protein kinase, interferon-inducible double stranded RNA dependent activator	Affinity Capture-MS	BioGRID	17353931
PRMT1	ANM1 \| HCP1 \| HRMT1L2 \| IR1B4	protein arginine methyltransferase 1	Biochemical Activity	BioGRID	12183049
PTPN11	BPTP3 \| CFC \| MGC14433 \| NS1 \| PTP-1D \| PTP2C \| SH-PTP2 \| SH-PTP3 \| SHP2	protein tyrosine phosphatase, non-receptor type 11	Two-hybrid	BioGRID	9847309
PUF60	FIR \| FLJ31379 \| RoBPI \| SIAHBP1	poly-U binding splicing factor 60KDa	Affinity Capture-MS	BioGRID	17353931
SMN1	BCD541 \| SMA \| SMA1 \| SMA2 \| SMA3 \| SMA4 \| SMA@ \| SMN \| SMNT \| T-BCD541	survival of motor neuron 1, telomeric	-	HPRD	11773003
STK24	MST-3 \| MST3 \| MST3B \| STE20 \| STK3	serine/threonine kinase 24 (STE20 homolog, yeast)	Affinity Capture-MS	BioGRID	17353931
SYT1	DKFZp781D2042 \| P65 \| SVP65 \| SYT	synaptotagmin I	-	HPRD,BioGRID	10734137
SYT11	DKFZp781D015 \| KIAA0080 \| MGC10881 \| MGC17226 \| SYT12	synaptotagmin XI	-	HPRD	10734137
SYT2	SytII	synaptotagmin II	-	HPRD,BioGRID	10734137
SYT3	DKFZp761O132 \| SytIII	synaptotagmin III	Reconstituted Complex	BioGRID	10734137
SYT4	HsT1192 \| KIAA1342	synaptotagmin IV	-	HPRD,BioGRID	10734137
SYT5	-	synaptotagmin V	-	HPRD	10734137
SYT7	IPCA-7 \| MGC150517 \| PCANAP7 \| SYT-VII	synaptotagmin VII	-	HPRD,BioGRID	10734137
SYT8	DKFZp434K0322	synaptotagmin VIII	Affinity Capture-Western Reconstituted Complex	BioGRID	10734137
SYT9	FLJ45896	synaptotagmin IX	-	HPRD,BioGRID	10734137

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
NAKAMURA CANCER MICROENVIRONMENT DN	46	29	All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP	285	181	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP	783	507	All SZGR 2.0 genes in this pathway
DAVICIONI MOLECULAR ARMS VS ERMS UP	332	228	All SZGR 2.0 genes in this pathway
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 UP	408	247	All SZGR 2.0 genes in this pathway
GARY CD5 TARGETS DN	431	263	All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER UP	404	246	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 DN	281	186	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 24HR UP	557	331	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 12HR DN	209	122	All SZGR 2.0 genes in this pathway
GRAHAM CML DIVIDING VS NORMAL QUIESCENT UP	181	101	All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES CD4 DN	116	71	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN	508	354	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN	770	415	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 6 7WK UP	197	135	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS BASAL	330	217	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER BASAL VS LULMINAL	330	215	All SZGR 2.0 genes in this pathway
SCHLOSSER MYC TARGETS AND SERUM RESPONSE DN	47	34	All SZGR 2.0 genes in this pathway
YANG BREAST CANCER ESR1 LASER DN	50	38	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK	779	480	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS UP	769	437	All SZGR 2.0 genes in this pathway
FERREIRA EWINGS SARCOMA UNSTABLE VS STABLE UP	167	92	All SZGR 2.0 genes in this pathway
LIU COMMON CANCER GENES	79	47	All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX	795	478	All SZGR 2.0 genes in this pathway
LIAO METASTASIS	539	324	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR UP	176	115	All SZGR 2.0 genes in this pathway
PASQUALUCCI LYMPHOMA BY GC STAGE DN	165	104	All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES	648	385	All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215	893	528	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 1 DN	169	102	All SZGR 2.0 genes in this pathway
SHEPARD CRUSH AND BURN MUTANT DN	185	111	All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER METASTASIS DN	121	65	All SZGR 2.0 genes in this pathway
FLECHNER PBL KIDNEY TRANSPLANT OK VS DONOR UP	151	100	All SZGR 2.0 genes in this pathway
FLECHNER PBL KIDNEY TRANSPLANT REJECTED VS OK DN	51	35	All SZGR 2.0 genes in this pathway
PENG RAPAMYCIN RESPONSE DN	245	154	All SZGR 2.0 genes in this pathway
PENG GLUTAMINE DEPRIVATION DN	337	230	All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION	475	313	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
HEDENFALK BREAST CANCER BRACX DN	20	14	All SZGR 2.0 genes in this pathway
HU GENOTOXIN ACTION DIRECT VS INDIRECT 24HR	55	38	All SZGR 2.0 genes in this pathway
HU GENOTOXIC DAMAGE 4HR	35	28	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN	911	527	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN	1011	592	All SZGR 2.0 genes in this pathway
MONNIER POSTRADIATION TUMOR ESCAPE UP	393	244	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL UP	648	398	All SZGR 2.0 genes in this pathway
ZHANG BREAST CANCER PROGENITORS UP	425	253	All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP	871	505	All SZGR 2.0 genes in this pathway
GRADE COLON AND RECTAL CANCER UP	285	167	All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB DN	342	220	All SZGR 2.0 genes in this pathway
MUELLER PLURINET	299	189	All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER ESR1 DN	240	153	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER POOR SURVIVAL A6	456	285	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 60HR DN	277	166	All SZGR 2.0 genes in this pathway
DORN ADENOVIRUS INFECTION 12HR DN	33	25	All SZGR 2.0 genes in this pathway
DORN ADENOVIRUS INFECTION 24HR UP	12	6	All SZGR 2.0 genes in this pathway
DORN ADENOVIRUS INFECTION 32HR DN	39	28	All SZGR 2.0 genes in this pathway
DORN ADENOVIRUS INFECTION 48HR DN	40	29	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 14	143	86	All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE M G1	148	95	All SZGR 2.0 genes in this pathway
KARLSSON TGFB1 TARGETS UP	127	78	All SZGR 2.0 genes in this pathway
HIRSCH CELLULAR TRANSFORMATION SIGNATURE DN	103	67	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 2 DN	336	211	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN	918	550	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN	882	538	All SZGR 2.0 genes in this pathway
IKEDA MIR1 TARGETS UP	53	39	All SZGR 2.0 genes in this pathway
JUBAN TARGETS OF SPI1 AND FLI1 DN	92	60	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS UP	279	155	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4	227	149	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-375	139	146	1A,m8	hsa-miR-375	UUUGUUCGUUCGGCUCGCGUGA
miR-381	365	371	m8	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-381	365	371	m8	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-382	393	399	1A	hsa-miR-382^brain	GAAGUUGUUCGUGGUGGAUUCG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SYNCRIP