Gene Page: ADD3
Summary ?
GeneID | 120 |
Symbol | ADD3 |
Synonyms | ADDL |
Description | adducin 3 |
Reference | MIM:601568|HGNC:HGNC:245|Ensembl:ENSG00000148700|HPRD:03339|Vega:OTTHUMG00000019032 |
Gene type | protein-coding |
Map location | 10q25.2 |
Pascal p-value | 0.548 |
Sherlock p-value | 0.655 |
Fetal beta | -1.427 |
eGene | Cerebellar Hemisphere Cerebellum Myers' cis & trans |
Support | STRUCTURAL PLASTICITY G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Expression | Meta-analysis of gene expression | P value: 1.57 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs9875049 | chr3 | 56457469 | ADD3 | 120 | 0.17 | trans | ||
rs2358472 | chr10 | 19963002 | ADD3 | 120 | 0.19 | trans | ||
rs2358473 | chr10 | 19963065 | ADD3 | 120 | 0.19 | trans | ||
rs1409742 | chr10 | 19965438 | ADD3 | 120 | 0.19 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
UNG | 0.89 | 0.87 |
RNF122 | 0.88 | 0.77 |
EFNB1 | 0.88 | 0.75 |
NRM | 0.86 | 0.79 |
LMNB1 | 0.86 | 0.72 |
TRIP13 | 0.86 | 0.69 |
LRRC42 | 0.86 | 0.72 |
NUP107 | 0.86 | 0.77 |
H2AFY2 | 0.86 | 0.70 |
KDM1 | 0.85 | 0.69 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
C5orf53 | -0.58 | -0.64 |
FBXO2 | -0.56 | -0.59 |
CCNI2 | -0.56 | -0.64 |
ASPHD1 | -0.55 | -0.57 |
CA4 | -0.54 | -0.64 |
HLA-F | -0.54 | -0.57 |
AF347015.27 | -0.53 | -0.65 |
SLC9A3R2 | -0.53 | -0.47 |
SLC16A11 | -0.52 | -0.51 |
AIFM3 | -0.52 | -0.54 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003779 | actin binding | IEA | - | |
GO:0005516 | calmodulin binding | IEA | - | |
GO:0005200 | structural constituent of cytoskeleton | TAS | 8893809 | |
GO:0046872 | metal ion binding | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005856 | cytoskeleton | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0005886 | plasma membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN | 634 | 384 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA DN | 526 | 357 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN | 463 | 290 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA DN | 116 | 79 | All SZGR 2.0 genes in this pathway |
LIU CMYB TARGETS UP | 165 | 106 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS BASAL DN | 455 | 304 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN | 460 | 312 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC UP | 185 | 126 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
HAHTOLA MYCOSIS FUNGOIDES CD4 DN | 116 | 71 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER DN | 232 | 154 | All SZGR 2.0 genes in this pathway |
CHEBOTAEV GR TARGETS UP | 77 | 62 | All SZGR 2.0 genes in this pathway |
VANHARANTA UTERINE FIBROID DN | 67 | 45 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
HAMAI APOPTOSIS VIA TRAIL UP | 584 | 356 | All SZGR 2.0 genes in this pathway |
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
INGRAM SHH TARGETS UP | 127 | 79 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
ROPERO HDAC2 TARGETS | 114 | 71 | All SZGR 2.0 genes in this pathway |
WOTTON RUNX TARGETS DN | 29 | 18 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
BENPORATH OCT4 TARGETS | 290 | 172 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
BENPORATH NOS TARGETS | 179 | 105 | All SZGR 2.0 genes in this pathway |
ROZANOV MMP14 TARGETS UP | 266 | 171 | All SZGR 2.0 genes in this pathway |
DORSAM HOXA9 TARGETS UP | 35 | 25 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD UP | 131 | 87 | All SZGR 2.0 genes in this pathway |
THEILGAARD NEUTROPHIL AT SKIN WOUND DN | 225 | 163 | All SZGR 2.0 genes in this pathway |
XU RESPONSE TO TRETINOIN UP | 16 | 10 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP | 390 | 242 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 14HR DN | 298 | 200 | All SZGR 2.0 genes in this pathway |
WANG CISPLATIN RESPONSE AND XPC DN | 228 | 146 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 20HR DN | 101 | 70 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
LU AGING BRAIN UP | 262 | 186 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 18HR DN | 178 | 121 | All SZGR 2.0 genes in this pathway |
WELCSH BRCA1 TARGETS UP | 198 | 132 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 UP | 428 | 266 | All SZGR 2.0 genes in this pathway |
JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4 | 307 | 185 | All SZGR 2.0 genes in this pathway |
ZHENG BOUND BY FOXP3 | 491 | 310 | All SZGR 2.0 genes in this pathway |
ZHENG FOXP3 TARGETS IN THYMUS UP | 196 | 137 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS UP | 602 | 364 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS UP | 601 | 369 | All SZGR 2.0 genes in this pathway |
MASSARWEH TAMOXIFEN RESISTANCE DN | 258 | 160 | All SZGR 2.0 genes in this pathway |
MASSARWEH RESPONSE TO ESTRADIOL | 61 | 47 | All SZGR 2.0 genes in this pathway |
AMBROSINI FLAVOPIRIDOL TREATMENT TP53 | 109 | 63 | All SZGR 2.0 genes in this pathway |
MITSIADES RESPONSE TO APLIDIN DN | 249 | 165 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER LUMINAL B DN | 564 | 326 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER NORMAL LIKE UP | 476 | 285 | All SZGR 2.0 genes in this pathway |
BERNARD PPAPDC1B TARGETS DN | 58 | 39 | All SZGR 2.0 genes in this pathway |
CHUNG BLISTER CYTOTOXICITY DN | 44 | 29 | All SZGR 2.0 genes in this pathway |
GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
LABBE WNT3A TARGETS UP | 112 | 71 | All SZGR 2.0 genes in this pathway |
TOOKER GEMCITABINE RESISTANCE DN | 122 | 84 | All SZGR 2.0 genes in this pathway |
CHANG CORE SERUM RESPONSE DN | 209 | 137 | All SZGR 2.0 genes in this pathway |
ROME INSULIN TARGETS IN MUSCLE UP | 442 | 263 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER SURVIVAL UP | 73 | 49 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER SUBCLASS S2 | 115 | 74 | All SZGR 2.0 genes in this pathway |
MIKKELSEN ES ICP WITH H3K4ME3 | 718 | 401 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC ICP WITH H3K4ME3 | 445 | 257 | All SZGR 2.0 genes in this pathway |
NIELSEN LEIOMYOSARCOMA CNN1 DN | 20 | 18 | All SZGR 2.0 genes in this pathway |
NIELSEN LEIOMYOSARCOMA DN | 18 | 11 | All SZGR 2.0 genes in this pathway |
KARLSSON TGFB1 TARGETS DN | 207 | 139 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA NEURAL | 129 | 85 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS SENESCENT | 572 | 352 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
KASLER HDAC7 TARGETS 2 DN | 32 | 23 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS DN | 553 | 343 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
JUBAN TARGETS OF SPI1 AND FLI1 UP | 115 | 73 | All SZGR 2.0 genes in this pathway |
PEDERSEN METASTASIS BY ERBB2 ISOFORM 7 | 403 | 240 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
STEINER ERYTHROCYTE MEMBRANE GENES | 15 | 10 | All SZGR 2.0 genes in this pathway |
DELACROIX RARG BOUND MEF | 367 | 231 | All SZGR 2.0 genes in this pathway |
KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
ALFANO MYC TARGETS | 239 | 156 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY STEM CELL DN | 428 | 246 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-129-5p | 711 | 718 | 1A,m8 | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
miR-143 | 163 | 169 | m8 | hsa-miR-143brain | UGAGAUGAAGCACUGUAGCUCA |
miR-145 | 125 | 132 | 1A,m8 | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU | ||||
miR-155 | 436 | 442 | 1A | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
miR-18 | 1790 | 1796 | m8 | hsa-miR-18a | UAAGGUGCAUCUAGUGCAGAUA |
hsa-miR-18b | UAAGGUGCAUCUAGUGCAGUUA | ||||
miR-182 | 1137 | 1143 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA | ||||
miR-19 | 40 | 46 | 1A | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-27 | 1695 | 1701 | 1A | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-330 | 1818 | 1824 | m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
miR-361 | 1881 | 1887 | m8 | hsa-miR-361brain | UUAUCAGAAUCUCCAGGGGUAC |
miR-365 | 434 | 441 | 1A,m8 | hsa-miR-365 | UAAUGCCCCUAAAAAUCCUUAU |
miR-381 | 746 | 752 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
miR-450 | 711 | 717 | 1A | hsa-miR-450 | UUUUUGCGAUGUGUUCCUAAUA |
miR-455 | 495 | 502 | 1A,m8 | hsa-miR-455 | UAUGUGCCUUUGGACUACAUCG |
miR-543 | 1912 | 1918 | 1A | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
miR-96 | 1137 | 1143 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.