Gene Page: CLTB
Summary ?
| GeneID | 1212 |
| Symbol | CLTB |
| Synonyms | LCB |
| Description | clathrin light chain B |
| Reference | MIM:118970|HGNC:HGNC:2091|Ensembl:ENSG00000175416|HPRD:00352|Vega:OTTHUMG00000130662 |
| Gene type | protein-coding |
| Map location | 5q35 |
| Pascal p-value | 0.022 |
| Sherlock p-value | 0.533 |
| Fetal beta | -0.886 |
| DMG | 2 (# studies) |
| Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.human_clathrin G2Cdb.human_Synaptosome |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 2 |
| DMG:vanEijk_2014 | Genome-wide DNA methylation analysis | This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). | 2 |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.0276 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg20449228 | 5 | 175843814 | CLTB | 1.67E-8 | -0.007 | 6.13E-6 | DMG:Jaffe_2016 |
| cg08725962 | 5 | 175792493 | CLTB | 8.204E-4 | 4.546 | DMG:vanEijk_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005509 | calcium ion binding | IEA | - | |
| GO:0005515 | protein binding | IEA | - | |
| GO:0005198 | structural molecule activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006886 | intracellular protein transport | NAS | - | |
| GO:0016192 | vesicle-mediated transport | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016020 | membrane | IEA | - | |
| GO:0030132 | clathrin coat of coated pit | IEA | - | |
| GO:0030130 | clathrin coat of trans-Golgi network vesicle | IEA | - | |
| GO:0031410 | cytoplasmic vesicle | IEA | - | |
| GO:0030659 | cytoplasmic vesicle membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG LYSOSOME | 121 | 83 | All SZGR 2.0 genes in this pathway |
| KEGG ENDOCYTOSIS | 183 | 132 | All SZGR 2.0 genes in this pathway |
| KEGG HUNTINGTONS DISEASE | 185 | 109 | All SZGR 2.0 genes in this pathway |
| BIOCARTA ARAP PATHWAY | 18 | 13 | All SZGR 2.0 genes in this pathway |
| PID ARF 3PATHWAY | 19 | 13 | All SZGR 2.0 genes in this pathway |
| REACTOME GAP JUNCTION DEGRADATION | 10 | 8 | All SZGR 2.0 genes in this pathway |
| REACTOME MEMBRANE TRAFFICKING | 129 | 74 | All SZGR 2.0 genes in this pathway |
| REACTOME GAP JUNCTION TRAFFICKING | 27 | 19 | All SZGR 2.0 genes in this pathway |
| HOLLMANN APOPTOSIS VIA CD40 UP | 201 | 125 | All SZGR 2.0 genes in this pathway |
| ZHONG RESPONSE TO AZACITIDINE AND TSA UP | 183 | 119 | All SZGR 2.0 genes in this pathway |
| JAEGER METASTASIS DN | 258 | 141 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN MLL SIGNATURE 1 UP | 380 | 236 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
| CONCANNON APOPTOSIS BY EPOXOMICIN UP | 239 | 157 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 UP | 309 | 199 | All SZGR 2.0 genes in this pathway |
| DAIRKEE TERT TARGETS UP | 380 | 213 | All SZGR 2.0 genes in this pathway |
| PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
| LIAO METASTASIS | 539 | 324 | All SZGR 2.0 genes in this pathway |
| FRIDMAN SENESCENCE UP | 77 | 60 | All SZGR 2.0 genes in this pathway |
| FRIDMAN IMMORTALIZATION DN | 34 | 24 | All SZGR 2.0 genes in this pathway |
| PASQUALUCCI LYMPHOMA BY GC STAGE UP | 283 | 177 | All SZGR 2.0 genes in this pathway |
| AMIT SERUM RESPONSE 240 MCF10A | 57 | 36 | All SZGR 2.0 genes in this pathway |
| CERVERA SDHB TARGETS 2 | 114 | 76 | All SZGR 2.0 genes in this pathway |
| LE EGR2 TARGETS DN | 108 | 84 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
| ZHAN MULTIPLE MYELOMA CD1 AND CD2 DN | 51 | 32 | All SZGR 2.0 genes in this pathway |
| NADLER HYPERGLYCEMIA AT OBESITY | 58 | 35 | All SZGR 2.0 genes in this pathway |
| REN ALVEOLAR RHABDOMYOSARCOMA DN | 408 | 274 | All SZGR 2.0 genes in this pathway |
| MODY HIPPOCAMPUS POSTNATAL | 63 | 50 | All SZGR 2.0 genes in this pathway |
| DAZARD UV RESPONSE CLUSTER G3 | 15 | 10 | All SZGR 2.0 genes in this pathway |
| LU AGING BRAIN DN | 153 | 120 | All SZGR 2.0 genes in this pathway |
| LEE CALORIE RESTRICTION MUSCLE UP | 43 | 33 | All SZGR 2.0 genes in this pathway |
| LEE AGING MUSCLE DN | 46 | 29 | All SZGR 2.0 genes in this pathway |
| DAZARD RESPONSE TO UV NHEK UP | 244 | 151 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 24HR UP | 148 | 96 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 COMMON UP | 77 | 47 | All SZGR 2.0 genes in this pathway |
| MALONEY RESPONSE TO 17AAG DN | 79 | 45 | All SZGR 2.0 genes in this pathway |
| COLINA TARGETS OF 4EBP1 AND 4EBP2 | 356 | 214 | All SZGR 2.0 genes in this pathway |
| CHEOK RESPONSE TO MERCAPTOPURINE AND HD MTX DN | 25 | 18 | All SZGR 2.0 genes in this pathway |
| ROME INSULIN TARGETS IN MUSCLE DN | 204 | 114 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
| KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP B | 549 | 316 | All SZGR 2.0 genes in this pathway |
| KOHOUTEK CCNT1 TARGETS | 50 | 26 | All SZGR 2.0 genes in this pathway |
| PEDERSEN METASTASIS BY ERBB2 ISOFORM 7 | 403 | 240 | All SZGR 2.0 genes in this pathway |
| PECE MAMMARY STEM CELL UP | 146 | 75 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-329 | 261 | 267 | m8 | hsa-miR-329brain | AACACACCUGGUUAACCUCUUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.