Gene Page: DCBLD2
Summary ?
GeneID | 131566 |
Symbol | DCBLD2 |
Synonyms | CLCP1|ESDN |
Description | discoidin, CUB and LCCL domain containing 2 |
Reference | MIM:608698|HGNC:HGNC:24627|Ensembl:ENSG00000057019|HPRD:10567|Vega:OTTHUMG00000151985 |
Gene type | protein-coding |
Map location | 3q12.1|3 |
Pascal p-value | 0.367 |
Sherlock p-value | 0.038 |
Fetal beta | 0.914 |
DMG | 2 (# studies) |
eGene | Anterior cingulate cortex BA24 Cerebellar Hemisphere Cerebellum Frontal Cortex BA9 Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 2 |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04359 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.04047 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg07435592 | 3 | 98619796 | DCBLD2 | 3.072E-4 | 0.395 | 0.04 | DMG:Wockner_2014 |
cg07435592 | 3 | 98619796 | DCBLD2 | -0.025 | 0.26 | DMG:Nishioka_2013 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs16955618 | chr15 | 29937543 | DCBLD2 | 131566 | 0.14 | trans | ||
rs1082411 | 3 | 98757172 | DCBLD2 | ENSG00000057019.11 | 1.61461E-6 | 0.04 | -136639 | gtex_brain_ba24 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | NAS | 11447234 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007155 | cell adhesion | IEA | - | |
GO:0042060 | wound healing | IDA | 11447234 | |
GO:0042060 | wound healing | ISS | - | |
GO:0030522 | intracellular receptor-mediated signaling pathway | NAS | 11447234 | |
GO:0030308 | negative regulation of cell growth | IDA | 11447234 | |
GO:0030308 | negative regulation of cell growth | ISS | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0016020 | membrane | IEA | - | |
GO:0009986 | cell surface | IDA | 11447234 | |
GO:0009986 | cell surface | ISS | - | |
GO:0005887 | integral to plasma membrane | IDA | 11447234 | |
GO:0005887 | integral to plasma membrane | ISS | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
CHARAFE BREAST CANCER LUMINAL VS BASAL DN | 455 | 304 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN | 460 | 312 | All SZGR 2.0 genes in this pathway |
ODONNELL TFRC TARGETS UP | 456 | 228 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
WAMUNYOKOLI OVARIAN CANCER LMP DN | 199 | 124 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA DN | 77 | 52 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2A DN | 141 | 84 | All SZGR 2.0 genes in this pathway |
KAN RESPONSE TO ARSENIC TRIOXIDE | 123 | 80 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA2 PCC NETWORK | 423 | 265 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
WEI MYCN TARGETS WITH E BOX | 795 | 478 | All SZGR 2.0 genes in this pathway |
KOYAMA SEMA3B TARGETS UP | 292 | 168 | All SZGR 2.0 genes in this pathway |
WU CELL MIGRATION | 184 | 114 | All SZGR 2.0 genes in this pathway |
GEORGES TARGETS OF MIR192 AND MIR215 | 893 | 528 | All SZGR 2.0 genes in this pathway |
SUNG METASTASIS STROMA UP | 110 | 70 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 1 DN | 169 | 102 | All SZGR 2.0 genes in this pathway |
MOREAUX MULTIPLE MYELOMA BY TACI UP | 412 | 249 | All SZGR 2.0 genes in this pathway |
REN ALVEOLAR RHABDOMYOSARCOMA DN | 408 | 274 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP | 390 | 242 | All SZGR 2.0 genes in this pathway |
HENDRICKS SMARCA4 TARGETS UP | 56 | 35 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY DN | 145 | 88 | All SZGR 2.0 genes in this pathway |
BILD SRC ONCOGENIC SIGNATURE | 62 | 38 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
FOSTER TOLERANT MACROPHAGE UP | 156 | 92 | All SZGR 2.0 genes in this pathway |
HUANG DASATINIB RESISTANCE UP | 81 | 53 | All SZGR 2.0 genes in this pathway |
CHANG CORE SERUM RESPONSE UP | 212 | 128 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
KOBAYASHI EGFR SIGNALING 24HR DN | 251 | 151 | All SZGR 2.0 genes in this pathway |
WINNEPENNINCKX MELANOMA METASTASIS UP | 162 | 86 | All SZGR 2.0 genes in this pathway |
KYNG WERNER SYNDROM AND NORMAL AGING UP | 93 | 62 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA MESENCHYMAL | 216 | 130 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS SENESCENT | 572 | 352 | All SZGR 2.0 genes in this pathway |
HOELZEL NF1 TARGETS UP | 139 | 93 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN | 229 | 135 | All SZGR 2.0 genes in this pathway |
AZARE NEOPLASTIC TRANSFORMATION BY STAT3 UP | 121 | 70 | All SZGR 2.0 genes in this pathway |
PURBEY TARGETS OF CTBP1 NOT SATB1 UP | 344 | 215 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL UP | 289 | 184 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-101 | 228 | 234 | 1A | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
hsa-miR-101 | UACAGUACUGUGAUAACUGAAG | ||||
hsa-miR-101 | UACAGUACUGUGAUAACUGAAG | ||||
miR-103/107 | 313 | 320 | 1A,m8 | hsa-miR-103brain | AGCAGCAUUGUACAGGGCUAUGA |
hsa-miR-107brain | AGCAGCAUUGUACAGGGCUAUCA | ||||
miR-130/301 | 2716 | 2722 | m8 | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
miR-139 | 3245 | 3251 | m8 | hsa-miR-139brain | UCUACAGUGCACGUGUCU |
miR-144 | 228 | 234 | 1A | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG | ||||
miR-15/16/195/424/497 | 7 | 13 | m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
miR-17-5p/20/93.mr/106/519.d | 2718 | 2724 | m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-181 | 3218 | 3224 | 1A | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU | ||||
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-19 | 2715 | 2721 | m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-218 | 34 | 40 | m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-219 | 2373 | 2380 | 1A,m8 | hsa-miR-219brain | UGAUUGUCCAAACGCAAUUCU |
miR-23 | 2394 | 2401 | 1A,m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-24 | 2241 | 2247 | m8 | hsa-miR-24SZ | UGGCUCAGUUCAGCAGGAACAG |
miR-26 | 2994 | 3000 | 1A | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
miR-31 | 150 | 157 | 1A,m8 | hsa-miR-31 | AGGCAAGAUGCUGGCAUAGCUG |
miR-320 | 1959 | 1965 | 1A | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
miR-381 | 3263 | 3269 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
miR-494 | 2704 | 2711 | 1A,m8 | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
miR-542-3p | 95 | 101 | m8 | hsa-miR-542-3p | UGUGACAGAUUGAUAACUGAAA |
miR-9 | 1998 | 2004 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.