Gene Page: DLAT
Summary ?
| GeneID | 1737 |
| Symbol | DLAT |
| Synonyms | DLTA|PDC-E2|PDCE2 |
| Description | dihydrolipoamide S-acetyltransferase |
| Reference | MIM:608770|HGNC:HGNC:2896|Ensembl:ENSG00000150768|HPRD:10578|Vega:OTTHUMG00000133751 |
| Gene type | protein-coding |
| Map location | 11q23.1 |
| Pascal p-value | 0.906 |
| Sherlock p-value | 0.011 |
| Fetal beta | -0.903 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans |
| Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.human_clathrin G2Cdb.human_mitochondria G2Cdb.human_Synaptosome G2Cdb.humanNRC G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| GSMA_I | Genome scan meta-analysis | Psr: 0.006 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg06326072 | 11 | 111895455 | DLAT | 5.93E-5 | 0.656 | 0.023 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs1570589 | chr9 | 116874354 | DLAT | 1737 | 0.18 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| DLX1 | 0.96 | 0.90 |
| DLX2 | 0.96 | 0.90 |
| SP9 | 0.93 | 0.90 |
| AC018470.3 | 0.92 | 0.90 |
| ARX | 0.91 | 0.88 |
| SOX1 | 0.85 | 0.76 |
| AC117395.4 | 0.83 | 0.70 |
| MYO3A | 0.82 | 0.48 |
| AKNA | 0.82 | 0.58 |
| POU3F4 | 0.81 | 0.67 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.31 | -0.31 | -0.69 |
| C5orf53 | -0.30 | -0.57 |
| S100B | -0.30 | -0.65 |
| PTGDS | -0.30 | -0.57 |
| PTH1R | -0.30 | -0.51 |
| MT-CO2 | -0.30 | -0.70 |
| AF347015.27 | -0.30 | -0.68 |
| HLA-F | -0.30 | -0.56 |
| TINAGL1 | -0.30 | -0.54 |
| ALDOC | -0.30 | -0.52 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0005515 | protein binding | IEA | - | |
| GO:0005524 | ATP binding | IEA | - | |
| GO:0004812 | aminoacyl-tRNA ligase activity | IEA | - | |
| GO:0004742 | dihydrolipoyllysine-residue acetyltransferase activity | NAS | 3191998 | |
| GO:0016740 | transferase activity | IEA | - | |
| GO:0008415 | acyltransferase activity | IEA | - | |
| GO:0031405 | lipoic acid binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006418 | tRNA aminoacylation for protein translation | IEA | - | |
| GO:0006096 | glycolysis | IEA | - | |
| GO:0006090 | pyruvate metabolic process | IEA | - | |
| GO:0006085 | acetyl-CoA biosynthetic process | NAS | - | |
| GO:0008152 | metabolic process | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005737 | cytoplasm | IEA | - | |
| GO:0005739 | mitochondrion | IEA | - | |
| GO:0005967 | mitochondrial pyruvate dehydrogenase complex | NAS | 3191998 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG GLYCOLYSIS GLUCONEOGENESIS | 62 | 41 | All SZGR 2.0 genes in this pathway |
| KEGG CITRATE CYCLE TCA CYCLE | 32 | 23 | All SZGR 2.0 genes in this pathway |
| KEGG PYRUVATE METABOLISM | 40 | 26 | All SZGR 2.0 genes in this pathway |
| REACTOME PYRUVATE METABOLISM AND CITRIC ACID TCA CYCLE | 48 | 32 | All SZGR 2.0 genes in this pathway |
| REACTOME TCA CYCLE AND RESPIRATORY ELECTRON TRANSPORT | 141 | 85 | All SZGR 2.0 genes in this pathway |
| REACTOME REGULATION OF PYRUVATE DEHYDROGENASE PDH COMPLEX | 13 | 9 | All SZGR 2.0 genes in this pathway |
| REACTOME PYRUVATE METABOLISM | 19 | 14 | All SZGR 2.0 genes in this pathway |
| LIU SOX4 TARGETS DN | 309 | 191 | All SZGR 2.0 genes in this pathway |
| CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
| DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN | 320 | 184 | All SZGR 2.0 genes in this pathway |
| HORIUCHI WTAP TARGETS DN | 310 | 188 | All SZGR 2.0 genes in this pathway |
| TONKS TARGETS OF RUNX1 RUNX1T1 FUSION MONOCYTE UP | 204 | 140 | All SZGR 2.0 genes in this pathway |
| KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| MCBRYAN PUBERTAL BREAST 3 4WK UP | 214 | 144 | All SZGR 2.0 genes in this pathway |
| MCBRYAN PUBERTAL BREAST 4 5WK DN | 196 | 131 | All SZGR 2.0 genes in this pathway |
| MCBRYAN PUBERTAL TGFB1 TARGETS UP | 169 | 127 | All SZGR 2.0 genes in this pathway |
| LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
| GRUETZMANN PANCREATIC CANCER UP | 358 | 245 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
| PUJANA CHEK2 PCC NETWORK | 779 | 480 | All SZGR 2.0 genes in this pathway |
| MANALO HYPOXIA DN | 289 | 166 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
| WANG TARGETS OF MLL CBP FUSION DN | 45 | 31 | All SZGR 2.0 genes in this pathway |
| KUMAR TARGETS OF MLL AF9 FUSION | 405 | 264 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS EARLY PROGENITOR | 532 | 309 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| WANG SMARCE1 TARGETS DN | 371 | 218 | All SZGR 2.0 genes in this pathway |
| RODWELL AGING KIDNEY NO BLOOD DN | 150 | 93 | All SZGR 2.0 genes in this pathway |
| RODWELL AGING KIDNEY DN | 145 | 88 | All SZGR 2.0 genes in this pathway |
| BURTON ADIPOGENESIS 6 | 189 | 112 | All SZGR 2.0 genes in this pathway |
| STEIN ESRRA TARGETS UP | 388 | 234 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER RELAPSE IN BONE DN | 315 | 197 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
| BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
| ZHANG BREAST CANCER PROGENITORS UP | 425 | 253 | All SZGR 2.0 genes in this pathway |
| MOOTHA HUMAN MITODB 6 2002 | 429 | 260 | All SZGR 2.0 genes in this pathway |
| MOOTHA MITOCHONDRIA | 447 | 277 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
| STEIN ESRRA TARGETS | 535 | 325 | All SZGR 2.0 genes in this pathway |
| WONG EMBRYONIC STEM CELL CORE | 335 | 193 | All SZGR 2.0 genes in this pathway |
| KARLSSON TGFB1 TARGETS UP | 127 | 78 | All SZGR 2.0 genes in this pathway |
| GREGORY SYNTHETIC LETHAL WITH IMATINIB | 145 | 83 | All SZGR 2.0 genes in this pathway |
| LU EZH2 TARGETS DN | 414 | 237 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
| WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-182 | 944 | 950 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
| miR-96 | 943 | 950 | 1A,m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.