SZGR2

Summary ?

GeneID	1837
Symbol	DTNA
Synonyms	D18S892E\|DRP3\|DTN\|DTN-A\|LVNC1
Description	dystrobrevin alpha
Reference	MIM:601239\|HGNC:HGNC:3057\|Ensembl:ENSG00000134769\|HPRD:03141\|Vega:OTTHUMG00000132309
Gene type	protein-coding
Map location	18q12
Pascal p-value	0.033
Sherlock p-value	0.951
Fetal beta	-1.909
eGene	Cerebellar Hemisphere Meta
Support	G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.4164

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
HRH2	0.87	0.89
PITPNM2	0.87	0.87
RHOBTB2	0.87	0.86
PIP5K1C	0.86	0.86
OSBP2	0.86	0.88
MGAT5B	0.86	0.87
ABR	0.86	0.87
BAI2	0.86	0.87
ZDHHC8	0.86	0.85
BAIAP2	0.85	0.86

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
DBI	-0.51	-0.57
AF347015.21	-0.50	-0.43
PECI	-0.50	-0.54
NSBP1	-0.50	-0.54
GNG11	-0.50	-0.52
RAB13	-0.49	-0.57
AP002478.3	-0.48	-0.49
MYL12A	-0.48	-0.54
AL139819.3	-0.47	-0.49
C1orf54	-0.47	-0.49

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005509	calcium ion binding	IEA		-
GO:0005515	protein binding	IPI		11353857
GO:0008270	zinc ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007274	neuromuscular synaptic transmission	TAS	neuron, Synap (GO term level: 7)	9119373
GO:0007165	signal transduction	TAS		10767327
GO:0006941	striated muscle contraction	TAS		10767327
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0045202	synapse	IEA	neuron, Synap, Neurotransmitter, Glial (GO term level: 2)	-
GO:0005737	cytoplasm	IEA		-
GO:0030054	cell junction	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
DMD	BMD \| CMD3B \| DXS142 \| DXS164 \| DXS206 \| DXS230 \| DXS239 \| DXS268 \| DXS269 \| DXS270 \| DXS272	dystrophin	-	HPRD,BioGRID	9356463
DRP2	MGC133255	dystrophin related protein 2	-	HPRD,BioGRID	10767429
DTNBP1	DBND \| DKFZp564K192 \| FLJ30031 \| HPS7 \| MGC20210 \| My031 \| SDY	dystrobrevin binding protein 1	-	HPRD	11316798
KCNJ12	FLJ14167 \| IRK2 \| KCNJN1 \| Kir2.2 \| Kir2.2v \| hIRK \| hIRK1 \| hkir2.2x \| kcnj12x	potassium inwardly-rectifying channel, subfamily J, member 12	-	HPRD,BioGRID	15024025
SNTA1	SNT1 \| TACIP1 \| dJ1187J4.5	syntrophin, alpha 1 (dystrophin-associated protein A1, 59kDa, acidic component)	-	HPRD	12206805
SNTA1	SNT1 \| TACIP1 \| dJ1187J4.5	syntrophin, alpha 1 (dystrophin-associated protein A1, 59kDa, acidic component)	-	HPRD	11069112 \|12206805\|12206805
SNTB1	59-DAP \| A1B \| BSYN2 \| DAPA1B \| FLJ22442 \| MGC111389 \| SNT2 \| SNT2B1 \| TIP-43	syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)	-	HPRD	10545507
SNTB1	59-DAP \| A1B \| BSYN2 \| DAPA1B \| FLJ22442 \| MGC111389 \| SNT2 \| SNT2B1 \| TIP-43	syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)	-	HPRD	7844150 \|10545507 \|11069112\|10545507
SNTB2	D16S2531E \| EST25263 \| SNT2B2 \| SNT3 \| SNTL	syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2)	-	HPRD	12206805
SNTG1	G1SYN \| SYN4	syntrophin, gamma 1	-	HPRD	10747910
SNTG2	G2SYN \| MGC133174 \| SYN5	syntrophin, gamma 2	-	HPRD	10747910
SRC	ASV \| SRC1 \| c-SRC \| p60-Src	v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)	-	HPRD	9701558
SYNC	MGC149625 \| MGC149626 \| SYNC1 \| SYNCOILIN	syncoilin, intermediate filament protein	-	HPRD	11053421
SYNM	DMN \| KIAA0353 \| SYN	synemin, intermediate filament protein	-	HPRD,BioGRID	11353857
UTRN	DMDL \| DRP \| DRP1 \| FLJ23678	utrophin	-	HPRD,BioGRID	9701558 \|12034776
UTRN	DMDL \| DRP \| DRP1 \| FLJ23678	utrophin	-	HPRD	9701558 \|10767429 \|12034776

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
LIU PROSTATE CANCER DN	481	290	All SZGR 2.0 genes in this pathway
SCHUETZ BREAST CANCER DUCTAL INVASIVE DN	84	53	All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS DN	352	225	All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY DN	367	220	All SZGR 2.0 genes in this pathway
SENESE HDAC1 AND HDAC2 TARGETS DN	232	139	All SZGR 2.0 genes in this pathway
SENESE HDAC2 TARGETS DN	133	77	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN	536	332	All SZGR 2.0 genes in this pathway
LEE NEURAL CREST STEM CELL DN	118	79	All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA UP	171	112	All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA BY DMOG UP	130	85	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN	805	505	All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN	781	465	All SZGR 2.0 genes in this pathway
CONCANNON APOPTOSIS BY EPOXOMICIN UP	239	157	All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS A UP	191	128	All SZGR 2.0 genes in this pathway
LIAO METASTASIS	539	324	All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS	988	594	All SZGR 2.0 genes in this pathway
BENPORATH OCT4 TARGETS	290	172	All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS	734	436	All SZGR 2.0 genes in this pathway
BENPORATH NOS TARGETS	179	105	All SZGR 2.0 genes in this pathway
MORI SMALL PRE BII LYMPHOCYTE UP	86	57	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA MS UP	48	32	All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP	314	201	All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION NEOCORTEX UP	83	66	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 14HR DN	298	200	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN	504	323	All SZGR 2.0 genes in this pathway
SAFFORD T LYMPHOCYTE ANERGY	87	54	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1	528	324	All SZGR 2.0 genes in this pathway
FUJII YBX1 TARGETS DN	202	132	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER WITH H3K27ME3 DN	228	114	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 60HR UP	293	203	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS UP	518	299	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS DN	668	419	All SZGR 2.0 genes in this pathway
ROME INSULIN TARGETS IN MUSCLE UP	442	263	All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION	422	277	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC ICP WITH H3K4ME3	445	257	All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 UP	397	206	All SZGR 2.0 genes in this pathway
PHESSE TARGETS OF APC AND MBD2 DN	13	11	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
IKEDA MIR30 TARGETS UP	116	87	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124.1	1146	1152	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	1146	1152	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	1146	1152	1A	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-128	887	893	1A	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	887	893	1A	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-135	772	778	1A	hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
				hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
				hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
				hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
miR-140	931	938	1A,m8	hsa-miR-140^brain	AGUGGUUUUACCCUAUGGUAG
miR-143	2149	2155	m8	hsa-miR-143^brain	UGAGAUGAAGCACUGUAGCUCA
miR-146	2086	2093	1A,m8	hsa-miR-146a	UGAGAACUGAAUUCCAUGGGUU
miR-146	2086	2093	1A,m8	hsa-miR-146b^brain	UGAGAACUGAAUUCCAUAGGCU
miR-148/152	3149	3155	1A	hsa-miR-148a	UCAGUGCACUACAGAACUUUGU
				hsa-miR-152^brain	UCAGUGCAUGACAGAACUUGGG
				hsa-miR-148b	UCAGUGCAUCACAGAACUUUGU
				hsa-miR-148a	UCAGUGCACUACAGAACUUUGU
				hsa-miR-152^brain	UCAGUGCAUGACAGAACUUGGG
				hsa-miR-148b	UCAGUGCAUCACAGAACUUUGU
miR-183	940	947	1A,m8	hsa-miR-183	UAUGGCACUGGUAGAAUUCACUG
miR-185	2675	2681	1A	hsa-miR-185^brain	UGGAGAGAAAGGCAGUUC
miR-19	2100	2107	1A,m8	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
				hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
				hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
				hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
				hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
				hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-22	213	219	1A	hsa-miR-22^brain	AAGCUGCCAGUUGAAGAACUGU
miR-24	3122	3128	1A	hsa-miR-24^SZ	UGGCUCAGUUCAGCAGGAACAG
miR-27	887	894	1A,m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
				hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
				hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
				hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-299-5p	930	936	1A	hsa-miR-299-5p	UGGUUUACCGUCCCACAUACAU
miR-30-5p	439	445	1A	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-320	1078	1085	1A,m8	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-365	3317	3323	m8	hsa-miR-365	UAAUGCCCCUAAAAAUCCUUAU
miR-376c	3101	3107	1A	hsa-miR-376c	AACAUAGAGGAAAUUCCACG
miR-378	2917	2923	1A	hsa-miR-378	CUCCUGACUCCAGGUCCUGUGU
miR-378	2917	2923	1A	hsa-miR-378	CUCCUGACUCCAGGUCCUGUGU
miR-410	3577	3583	m8	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-448	3115	3121	m8	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-9	2065	2071	m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: DTNA