Gene Page: EDN1
Summary ?
GeneID | 1906 |
Symbol | EDN1 |
Synonyms | ARCND3|ET1|HDLCQ7|PPET1|QME |
Description | endothelin 1 |
Reference | MIM:131240|HGNC:HGNC:3176|Ensembl:ENSG00000078401|HPRD:07030|Vega:OTTHUMG00000014266 |
Gene type | protein-coding |
Map location | 6p24.1 |
Pascal p-value | 0.247 |
Sherlock p-value | 0.504 |
Fetal beta | -0.167 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0159 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg16537245 | 6 | 12290035 | EDN1 | 2.55E-5 | -0.491 | 0.017 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs17077510 | chr3 | 45294294 | EDN1 | 1906 | 0.16 | trans | ||
rs16933426 | chr10 | 78113005 | EDN1 | 1906 | 0.16 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005179 | hormone activity | IDA | 2649896 |10770212 | |
GO:0031707 | endothelin A receptor binding | IEA | - | |
GO:0031708 | endothelin B receptor binding | IDA | 10770212 | |
GO:0031708 | endothelin B receptor binding | IPI | 1713452 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0043179 | rhythmic excitation | IEA | Synap (GO term level: 9) | - |
GO:0001569 | patterning of blood vessels | IEA | - | |
GO:0001666 | response to hypoxia | IEA | - | |
GO:0001701 | in utero embryonic development | IEA | - | |
GO:0003100 | regulation of systemic arterial blood pressure by endothelin | IDA | 2649896 | |
GO:0007205 | activation of protein kinase C activity | IEA | - | |
GO:0008217 | regulation of blood pressure | IEA | - | |
GO:0007267 | cell-cell signaling | IDA | 12379507 | |
GO:0010595 | positive regulation of endothelial cell migration | TAS | 8999856 | |
GO:0009953 | dorsal/ventral pattern formation | IEA | - | |
GO:0030195 | negative regulation of blood coagulation | TAS | 16820593 | |
GO:0048016 | inositol phosphate-mediated signaling | IDA | 1917960 | |
GO:0030072 | peptide hormone secretion | IDA | 10770212 | |
GO:0007507 | heart development | IEA | - | |
GO:0007585 | respiratory gaseous exchange | IEA | - | |
GO:0014032 | neural crest cell development | IEA | - | |
GO:0015758 | glucose transport | IEA | - | |
GO:0010460 | positive regulation of heart rate | IDA | 2649896 | |
GO:0006885 | regulation of pH | IEA | - | |
GO:0014065 | phosphoinositide 3-kinase cascade | IDA | 17078114 | |
GO:0019722 | calcium-mediated signaling | IDA | 1917960 |10770212 | |
GO:0042313 | protein kinase C deactivation | IDA | 16820593 | |
GO:0014824 | artery smooth muscle contraction | TAS | 1725334 | |
GO:0043507 | positive regulation of JNK activity | IDA | 12847114 | |
GO:0042474 | middle ear morphogenesis | IEA | - | |
GO:0051216 | cartilage development | IEA | - | |
GO:0019229 | regulation of vasoconstriction | IEA | - | |
GO:0030818 | negative regulation of cAMP biosynthetic process | IEA | - | |
GO:0031583 | G-protein signaling, phospholipase D activating pathway | IEA | - | |
GO:0030146 | diuresis | IEA | - | |
GO:0030147 | natriuresis | IEA | - | |
GO:0030185 | nitric oxide transport | IDA | 16820593 | |
GO:0045321 | leukocyte activation | TAS | 16820593 | |
GO:0045840 | positive regulation of mitosis | IDA | 10770212 | |
GO:0046887 | positive regulation of hormone secretion | IDA | 10770212 | |
GO:0045793 | positive regulation of cell size | IDA | 12847114 | |
GO:0045987 | positive regulation of smooth muscle contraction | IEA | - | |
GO:0048514 | blood vessel morphogenesis | IEA | - | |
GO:0048661 | positive regulation of smooth muscle cell proliferation | IDA | 10393673 | |
GO:0045429 | positive regulation of nitric oxide biosynthetic process | TAS | 8999856 | |
GO:0051482 | elevation of cytosolic calcium ion concentration during G-protein signaling, coupled to IP3 second messenger (phospholipase C activating) | IEA | - | |
GO:0051771 | negative regulation of nitric-oxide synthase biosynthetic process | IDA | 16820593 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005576 | extracellular region | IEA | - | |
GO:0005615 | extracellular space | IEA | - | |
GO:0005737 | cytoplasm | IDA | 12379507 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG MELANOGENESIS | 102 | 80 | All SZGR 2.0 genes in this pathway |
BIOCARTA HIF PATHWAY | 15 | 12 | All SZGR 2.0 genes in this pathway |
BIOCARTA NFAT PATHWAY | 56 | 45 | All SZGR 2.0 genes in this pathway |
BIOCARTA CARDIACEGF PATHWAY | 18 | 16 | All SZGR 2.0 genes in this pathway |
PID ENDOTHELIN PATHWAY | 63 | 52 | All SZGR 2.0 genes in this pathway |
PID AP1 PATHWAY | 70 | 60 | All SZGR 2.0 genes in this pathway |
PID HIF1 TFPATHWAY | 66 | 52 | All SZGR 2.0 genes in this pathway |
REACTOME GASTRIN CREB SIGNALLING PATHWAY VIA PKC AND MAPK | 205 | 136 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
REACTOME PEPTIDE LIGAND BINDING RECEPTORS | 188 | 108 | All SZGR 2.0 genes in this pathway |
REACTOME CLASS A1 RHODOPSIN LIKE RECEPTORS | 305 | 177 | All SZGR 2.0 genes in this pathway |
REACTOME G ALPHA Q SIGNALLING EVENTS | 184 | 116 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR LIGAND BINDING | 408 | 246 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LIVE UP | 485 | 293 | All SZGR 2.0 genes in this pathway |
THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
DOANE RESPONSE TO ANDROGEN DN | 241 | 146 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 6HR UP | 85 | 54 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 TARGETS DN | 260 | 143 | All SZGR 2.0 genes in this pathway |
SENESE HDAC2 TARGETS DN | 133 | 77 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LPS UP | 431 | 237 | All SZGR 2.0 genes in this pathway |
NAGASHIMA NRG1 SIGNALING UP | 176 | 123 | All SZGR 2.0 genes in this pathway |
NAGASHIMA EGF SIGNALING UP | 58 | 40 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
MARKEY RB1 CHRONIC LOF DN | 118 | 78 | All SZGR 2.0 genes in this pathway |
OLSSON E2F3 TARGETS DN | 49 | 33 | All SZGR 2.0 genes in this pathway |
DEBOSSCHER NFKB TARGETS REPRESSED BY GLUCOCORTICOIDS | 24 | 18 | All SZGR 2.0 genes in this pathway |
RASHI RESPONSE TO IONIZING RADIATION 2 | 127 | 92 | All SZGR 2.0 genes in this pathway |
SASAI RESISTANCE TO NEOPLASTIC TRANSFROMATION | 50 | 31 | All SZGR 2.0 genes in this pathway |
WILLIAMS ESR2 TARGETS DN | 11 | 6 | All SZGR 2.0 genes in this pathway |
GROSS ELK3 TARGETS UP | 27 | 16 | All SZGR 2.0 genes in this pathway |
GROSS HYPOXIA VIA ELK3 DN | 156 | 106 | All SZGR 2.0 genes in this pathway |
GROSS HYPOXIA VIA HIF1A DN | 110 | 78 | All SZGR 2.0 genes in this pathway |
GROSS HYPOXIA VIA ELK3 AND HIF1A UP | 142 | 104 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP | 487 | 286 | All SZGR 2.0 genes in this pathway |
SCHAEFFER SOX9 TARGETS IN PROSTATE DEVELOPMENT UP | 21 | 19 | All SZGR 2.0 genes in this pathway |
GOTZMANN EPITHELIAL TO MESENCHYMAL TRANSITION UP | 69 | 55 | All SZGR 2.0 genes in this pathway |
AMIT SERUM RESPONSE 120 MCF10A | 65 | 44 | All SZGR 2.0 genes in this pathway |
ZHANG RESPONSE TO IKK INHIBITOR AND TNF UP | 223 | 140 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 1 DN | 169 | 102 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 3 DN | 59 | 32 | All SZGR 2.0 genes in this pathway |
CERVERA SDHB TARGETS 1 UP | 118 | 66 | All SZGR 2.0 genes in this pathway |
LEE LIVER CANCER ACOX1 UP | 64 | 40 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
MANALO HYPOXIA UP | 207 | 145 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA LB UP | 48 | 28 | All SZGR 2.0 genes in this pathway |
HARRIS HYPOXIA | 81 | 64 | All SZGR 2.0 genes in this pathway |
CHUANG OXIDATIVE STRESS RESPONSE UP | 28 | 18 | All SZGR 2.0 genes in this pathway |
LEE CALORIE RESTRICTION NEOCORTEX DN | 88 | 58 | All SZGR 2.0 genes in this pathway |
SEMENZA HIF1 TARGETS | 36 | 32 | All SZGR 2.0 genes in this pathway |
CLASPER LYMPHATIC VESSELS DURING METASTASIS UP | 20 | 12 | All SZGR 2.0 genes in this pathway |
SANSOM APC TARGETS | 212 | 121 | All SZGR 2.0 genes in this pathway |
SANSOM WNT PATHWAY REQUIRE MYC | 58 | 43 | All SZGR 2.0 genes in this pathway |
FOSTER TOLERANT MACROPHAGE DN | 409 | 268 | All SZGR 2.0 genes in this pathway |
MASSARWEH TAMOXIFEN RESISTANCE UP | 578 | 341 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER RELAPSE IN BONE DN | 315 | 197 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER LUMINAL B DN | 564 | 326 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
LU TUMOR ANGIOGENESIS UP | 25 | 22 | All SZGR 2.0 genes in this pathway |
WINTER HYPOXIA METAGENE | 242 | 168 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS DN | 366 | 257 | All SZGR 2.0 genes in this pathway |
SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
SCHOEN NFKB SIGNALING | 34 | 26 | All SZGR 2.0 genes in this pathway |
DANG REGULATED BY MYC DN | 253 | 192 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 24HR DN | 505 | 328 | All SZGR 2.0 genes in this pathway |
DELPUECH FOXO3 TARGETS UP | 68 | 49 | All SZGR 2.0 genes in this pathway |
WIEDERSCHAIN TARGETS OF BMI1 AND PCGF2 | 57 | 39 | All SZGR 2.0 genes in this pathway |
WINZEN DEGRADED VIA KHSRP | 100 | 70 | All SZGR 2.0 genes in this pathway |
KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
IKEDA MIR1 TARGETS UP | 53 | 39 | All SZGR 2.0 genes in this pathway |
YANG BCL3 TARGETS UP | 364 | 236 | All SZGR 2.0 genes in this pathway |
KRIEG HYPOXIA VIA KDM3A | 53 | 34 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL UP | 289 | 184 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 3 TRANSIENTLY INDUCED BY EGF | 222 | 159 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-1/206 | 143 | 150 | 1A,m8 | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
miR-125/351 | 388 | 394 | 1A | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
miR-203.1 | 383 | 390 | 1A,m8 | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
miR-378* | 404 | 410 | m8 | hsa-miR-422b | CUGGACUUGGAGUCAGAAGGCC |
hsa-miR-422a | CUGGACUUAGGGUCAGAAGGCC | ||||
miR-409-3p | 142 | 148 | m8 | hsa-miR-409-3p | CGAAUGUUGCUCGGUGAACCCCU |
miR-455 | 380 | 386 | m8 | hsa-miR-455 | UAUGUGCCUUUGGACUACAUCG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.