SZGR2

Summary ?

GeneID	1983
Symbol	EIF5
Synonyms	EIF-5\|EIF-5A
Description	eukaryotic translation initiation factor 5
Reference	MIM:601710\|HGNC:HGNC:3299\|Ensembl:ENSG00000100664\|HPRD:03417\|Vega:OTTHUMG00000171839
Gene type	protein-coding
Map location	14q32.32
Pascal p-value	3.742E-7
Sherlock p-value	0.908
Fetal beta	-1.295
eGene	Anterior cingulate cortex BA24 Meta
Support	CompositeSet

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:PGCnp	Genome-wide Association Study	GWAS
DNM:Girard_2011	Whole Exome Sequencing analysis	The data set included 15 DNMs found from the exomes of 14 schizophrenia probands and their parents.
Expression	Meta-analysis of gene expression	P value: 2.502

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
EIF5	chr14	103806120	A	G	NM_001969 NM_183004	p.351I>V p.351I>V	missense missense			Schizophrenia	DNM:Girard_2011

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs62006272	14	103972990	EIF5	ENSG00000100664.6	3.28551E-6	0.05	173109	gtex_brain_ba24

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
EPC1	0.97	0.94
NUP160	0.96	0.94
KDM4A	0.96	0.94
FUBP1	0.96	0.93
RAF1	0.96	0.95
VPRBP	0.96	0.94
SETDB1	0.96	0.94
SSRP1	0.95	0.93
GART	0.95	0.92
C9orf97	0.95	0.94

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
C5orf53	-0.74	-0.74
AF347015.31	-0.73	-0.88
AIFM3	-0.73	-0.76
AF347015.27	-0.73	-0.87
HLA-F	-0.73	-0.74
MT-CO2	-0.72	-0.89
FXYD1	-0.72	-0.87
IFI27	-0.72	-0.86
AF347015.33	-0.71	-0.85
S100B	-0.71	-0.79

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0003743	translation initiation factor activity	NAS		8663286
GO:0003924	GTPase activity	TAS		8663286
GO:0005525	GTP binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006446	regulation of translational initiation	TAS		8663286
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005829	cytosol	NAS		8663286
GO:0005737	cytoplasm	TAS		8663286

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BIOCARTA EIF PATHWAY	16	9	All SZGR 2.0 genes in this pathway
BIOCARTA EIF2 PATHWAY	11	8	All SZGR 2.0 genes in this pathway
REACTOME TRANSLATION	222	75	All SZGR 2.0 genes in this pathway
REACTOME METABOLISM OF PROTEINS	518	242	All SZGR 2.0 genes in this pathway
PARENT MTOR SIGNALING DN	46	29	All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP	285	181	All SZGR 2.0 genes in this pathway
PICCALUGA ANGIOIMMUNOBLASTIC LYMPHOMA DN	136	86	All SZGR 2.0 genes in this pathway
GARY CD5 TARGETS DN	431	263	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER UP	404	246	All SZGR 2.0 genes in this pathway
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS BLUE UP	136	80	All SZGR 2.0 genes in this pathway
NAGASHIMA NRG1 SIGNALING UP	176	123	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP	722	443	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE UP	530	342	All SZGR 2.0 genes in this pathway
CONCANNON APOPTOSIS BY EPOXOMICIN UP	239	157	All SZGR 2.0 genes in this pathway
LUI THYROID CANCER PAX8 PPARG DN	45	29	All SZGR 2.0 genes in this pathway
SEIDEN ONCOGENESIS BY MET	88	53	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN	712	443	All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS UP	414	287	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN	584	395	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP	1037	673	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX	795	478	All SZGR 2.0 genes in this pathway
CAFFAREL RESPONSE TO THC 24HR 5 DN	59	35	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 1 DN	169	102	All SZGR 2.0 genes in this pathway
SWEET KRAS TARGETS DN	66	39	All SZGR 2.0 genes in this pathway
PENG LEUCINE DEPRIVATION DN	187	122	All SZGR 2.0 genes in this pathway
BROCKE APOPTOSIS REVERSED BY IL6	144	98	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST DN	309	206	All SZGR 2.0 genes in this pathway
PENG GLUTAMINE DEPRIVATION DN	337	230	All SZGR 2.0 genes in this pathway
THEILGAARD NEUTROPHIL AT SKIN WOUND UP	77	52	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 8HR UP	105	73	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
ZHU CMV ALL UP	120	89	All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C0	107	72	All SZGR 2.0 genes in this pathway
ZHU CMV 24 HR UP	93	65	All SZGR 2.0 genes in this pathway
XU GH1 AUTOCRINE TARGETS DN	142	94	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP	953	554	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP	783	442	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED	1022	619	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS DN	292	189	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS SILENCED BY METHYLATION DN	281	179	All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL CULTURED VS FRESH UP	425	298	All SZGR 2.0 genes in this pathway
BRUECKNER TARGETS OF MIRLET7A3 DN	78	49	All SZGR 2.0 genes in this pathway
CHEN HOXA5 TARGETS 9HR UP	223	132	All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB UP	245	159	All SZGR 2.0 genes in this pathway
ALONSO METASTASIS UP	198	128	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA D CLUSTER UP	27	19	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA D UP	89	62	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN	366	257	All SZGR 2.0 genes in this pathway
RUIZ TNC TARGETS DN	142	79	All SZGR 2.0 genes in this pathway
CROONQUIST NRAS SIGNALING DN	72	47	All SZGR 2.0 genes in this pathway
SETLUR PROSTATE CANCER TMPRSS2 ERG FUSION UP	67	48	All SZGR 2.0 genes in this pathway
KARLSSON TGFB1 TARGETS UP	127	78	All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE DN	841	431	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP	548	370	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN	918	550	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS DN	553	343	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS UP	279	155	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-101	926	932	1A	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-103/107	32	39	1A,m8	hsa-miR-103^brain	AGCAGCAUUGUACAGGGCUAUGA
miR-103/107	32	39	1A,m8	hsa-miR-107^brain	AGCAGCAUUGUACAGGGCUAUCA
miR-144	925	932	1A,m8	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-149	57	63	1A	hsa-miR-149^brain	UCUGGCUCCGUGUCUUCACUCC
miR-182	1968	1974	1A	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-182	1968	1974	1A	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-26	2091	2097	m8	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	2091	2097	m8	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-31	1036	1043	1A,m8	hsa-miR-31	AGGCAAGAUGCUGGCAUAGCUG
miR-494	220	226	m8	hsa-miR-494^brain	UGAAACAUACACGGGAAACCUCUU
miR-542-3p	1710	1716	1A	hsa-miR-542-3p	UGUGACAGAUUGAUAACUGAAA
miR-9	1716	1723	1A,m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA
miR-96	1039	1045	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC
miR-96	1039	1045	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: EIF5