Gene Page: ENSA
Summary ?
| GeneID | 2029 |
| Symbol | ENSA |
| Synonyms | ARPP-19e |
| Description | endosulfine alpha |
| Reference | MIM:603061|HGNC:HGNC:3360|Ensembl:ENSG00000143420|HPRD:11927|Vega:OTTHUMG00000035004 |
| Gene type | protein-coding |
| Map location | 1q21.3 |
| DEG p-value | DEG:Zhao_2015:p=3.17e-04:q=0.0924 |
| Fetal beta | -1.231 |
| eGene | Myers' cis & trans |
| Support | INTRACELLULAR SIGNAL TRANSDUCTION |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DEG:Zhao_2015 | RNA Sequencing analysis | Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder. | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 | |
| Expression | Meta-analysis of gene expression | P value: 2.04 | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs12139286 | chr1 | 150262454 | ENSA | 2029 | 0.15 | cis |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MED13 | 0.88 | 0.89 |
| LASS6 | 0.88 | 0.93 |
| ZNF148 | 0.88 | 0.90 |
| SPAST | 0.88 | 0.90 |
| BICD1 | 0.88 | 0.90 |
| PDS5A | 0.87 | 0.90 |
| PPP2R5E | 0.87 | 0.92 |
| UBXN2B | 0.87 | 0.93 |
| CAPRIN1 | 0.87 | 0.91 |
| ZMYM4 | 0.87 | 0.91 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| FXYD1 | -0.67 | -0.84 |
| AIFM3 | -0.67 | -0.76 |
| TSC22D4 | -0.66 | -0.77 |
| HEPN1 | -0.66 | -0.75 |
| S100B | -0.65 | -0.79 |
| AF347015.31 | -0.65 | -0.81 |
| AF347015.33 | -0.65 | -0.81 |
| MT-CO2 | -0.65 | -0.83 |
| HSD17B14 | -0.64 | -0.76 |
| AF347015.27 | -0.64 | -0.80 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005102 | receptor binding | TAS | Neurotransmitter (GO term level: 4) | 9653196 |
| GO:0008200 | ion channel inhibitor activity | TAS | 9653196 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007584 | response to nutrient | TAS | 9653196 | |
| GO:0006810 | transport | TAS | 9653196 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN | 634 | 384 | All SZGR 2.0 genes in this pathway |
| WATANABE RECTAL CANCER RADIOTHERAPY RESPONSIVE DN | 92 | 51 | All SZGR 2.0 genes in this pathway |
| HOLLMANN APOPTOSIS VIA CD40 UP | 201 | 125 | All SZGR 2.0 genes in this pathway |
| GARY CD5 TARGETS DN | 431 | 263 | All SZGR 2.0 genes in this pathway |
| THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
| CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP | 450 | 256 | All SZGR 2.0 genes in this pathway |
| ODONNELL METASTASIS DN | 24 | 13 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
| SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP | 479 | 299 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
| BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
| BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
| YAGI AML RELAPSE PROGNOSIS | 35 | 24 | All SZGR 2.0 genes in this pathway |
| YAGI AML SURVIVAL | 129 | 87 | All SZGR 2.0 genes in this pathway |
| NOUZOVA TRETINOIN AND H4 ACETYLATION | 143 | 85 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS EARLY PROGENITOR | 532 | 309 | All SZGR 2.0 genes in this pathway |
| LU AGING BRAIN DN | 153 | 120 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
| LIN MELANOMA COPY NUMBER UP | 73 | 53 | All SZGR 2.0 genes in this pathway |
| BONOME OVARIAN CANCER SURVIVAL OPTIMAL DEBULKING | 246 | 152 | All SZGR 2.0 genes in this pathway |
| BERNARD PPAPDC1B TARGETS UP | 40 | 20 | All SZGR 2.0 genes in this pathway |
| WEST ADRENOCORTICAL TUMOR UP | 294 | 199 | All SZGR 2.0 genes in this pathway |
| RUTELLA RESPONSE TO CSF2RB AND IL4 UP | 338 | 225 | All SZGR 2.0 genes in this pathway |
| RUTELLA RESPONSE TO HGF UP | 418 | 282 | All SZGR 2.0 genes in this pathway |
| RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 DN | 245 | 150 | All SZGR 2.0 genes in this pathway |
| ROME INSULIN TARGETS IN MUSCLE UP | 442 | 263 | All SZGR 2.0 genes in this pathway |
| YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 12 | 79 | 54 | All SZGR 2.0 genes in this pathway |
| MARTENS BOUND BY PML RARA FUSION | 456 | 287 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
| KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
| LU EZH2 TARGETS UP | 295 | 155 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| PURBEY TARGETS OF CTBP1 AND SATB1 DN | 180 | 116 | All SZGR 2.0 genes in this pathway |
| PURBEY TARGETS OF CTBP1 NOT SATB1 UP | 344 | 215 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-143 | 2027 | 2033 | m8 | hsa-miR-143brain | UGAGAUGAAGCACUGUAGCUCA |
| miR-15/16/195/424/497 | 1134 | 1140 | 1A | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
| hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
| hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
| hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
| hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
| hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
| miR-410 | 1988 | 1994 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
| miR-503 | 1134 | 1140 | 1A | hsa-miR-503 | UAGCAGCGGGAACAGUUCUGCAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.