SZGR2

Summary ?

GeneID	23092
Symbol	ARHGAP26
Synonyms	GRAF\|GRAF1\|OPHN1L\|OPHN1L1
Description	Rho GTPase activating protein 26
Reference	MIM:605370\|HGNC:HGNC:17073\|Ensembl:ENSG00000145819\|HPRD:05643\|Vega:OTTHUMG00000059705
Gene type	protein-coding
Map location	5q31
Pascal p-value	0.603
Sherlock p-value	0.528
Fetal beta	-2.212
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I	Genome scan meta-analysis	Psr: 0.0032
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.00459
GSMA_IIE	Genome scan meta-analysis (European-ancestry samples)	Psr: 0.01718
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg11796181	5	142422241	ARHGAP26	5.408E-4	0.524	0.048	DMG:Wockner_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs7569357	chr2	74778643	ARHGAP26	23092		0.09		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005100	Rho GTPase activator activity	NAS		10908648
GO:0005096	GTPase activator activity	IEA		-
GO:0005515	protein binding	IPI		11432776
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007399	nervous system development	NAS	neurite (GO term level: 5)	9582072
GO:0007165	signal transduction	IEA		-
GO:0030036	actin cytoskeleton organization	NAS		11998687
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005575	cellular_component	ND		-
GO:0005622	intracellular	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
ST INTEGRIN SIGNALING PATHWAY	82	62	All SZGR 2.0 genes in this pathway
PID FAK PATHWAY	59	45	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY RHO GTPASES	113	81	All SZGR 2.0 genes in this pathway
PARENT MTOR SIGNALING UP	567	375	All SZGR 2.0 genes in this pathway
DAVICIONI MOLECULAR ARMS VS ERMS UP	332	228	All SZGR 2.0 genes in this pathway
HOOI ST7 TARGETS UP	94	57	All SZGR 2.0 genes in this pathway
LIU VMYB TARGETS UP	127	78	All SZGR 2.0 genes in this pathway
DOANE RESPONSE TO ANDROGEN UP	184	125	All SZGR 2.0 genes in this pathway
HORIUCHI WTAP TARGETS UP	306	188	All SZGR 2.0 genes in this pathway
RODRIGUES NTN1 TARGETS DN	158	102	All SZGR 2.0 genes in this pathway
MAYBURD RESPONSE TO L663536 UP	29	18	All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS	355	243	All SZGR 2.0 genes in this pathway
MYLLYKANGAS AMPLIFICATION HOT SPOT 27	15	8	All SZGR 2.0 genes in this pathway
EBAUER TARGETS OF PAX3 FOXO1 FUSION DN	48	31	All SZGR 2.0 genes in this pathway
NING CHRONIC OBSTRUCTIVE PULMONARY DISEASE DN	121	79	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
XU GH1 AUTOCRINE TARGETS UP	268	157	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3	720	440	All SZGR 2.0 genes in this pathway
RIGGINS TAMOXIFEN RESISTANCE UP	66	44	All SZGR 2.0 genes in this pathway
FOSTER TOLERANT MACROPHAGE DN	409	268	All SZGR 2.0 genes in this pathway
BRUECKNER TARGETS OF MIRLET7A3 UP	111	69	All SZGR 2.0 genes in this pathway
BREDEMEYER RAG SIGNALING NOT VIA ATM DN	57	34	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA D DN	78	34	All SZGR 2.0 genes in this pathway
ROME INSULIN TARGETS IN MUSCLE DN	204	114	All SZGR 2.0 genes in this pathway
ZEMBUTSU SENSITIVITY TO MITOMYCIN	19	11	All SZGR 2.0 genes in this pathway
KARLSSON TGFB1 TARGETS UP	127	78	All SZGR 2.0 genes in this pathway
HOELZEL NF1 TARGETS UP	139	93	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 UP	430	288	All SZGR 2.0 genes in this pathway
SERVITJA LIVER HNF1A TARGETS DN	157	105	All SZGR 2.0 genes in this pathway
WANG MLL TARGETS	289	188	All SZGR 2.0 genes in this pathway
DURAND STROMA NS UP	162	103	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-101	6191	6197	1A	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-101	6191	6197	1A	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-144	6190	6197	1A,m8	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-144	6190	6197	1A,m8	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-145	3433	3439	m8	hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCUU
miR-17-5p/20/93.mr/106/519.d	6240	6247	1A,m8	hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
miR-214	19	25	1A	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG
miR-26	1629	1635	1A	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	1629	1635	1A	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-34/449	1239	1246	1A,m8	hsa-miR-34a^brain	UGGCAGUGUCUUAGCUGGUUGUU
				hsa-miR-34c	AGGCAGUGUAGUUAGCUGAUUGC
				hsa-miR-449	UGGCAGUGUAUUGUUAGCUGGU
				hsa-miR-449b	AGGCAGUGUAUUGUUAGCUGGC
miR-377	6204	6210	m8	hsa-miR-377	AUCACACAAAGGCAACUUUUGU
miR-409-5p	705	711	1A	hsa-miR-409-5p	AGGUUACCCGAGCAACUUUGCA
miR-505	1638	1645	1A,m8	hsa-miR-505	GUCAACACUUGCUGGUUUCCUC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: ARHGAP26