SZGR2

Summary ?

GeneID	23518
Symbol	R3HDM1
Synonyms	R3HDM
Description	R3H domain containing 1
Reference	HGNC:HGNC:9757\|Ensembl:ENSG00000048991\|HPRD:10180\|Vega:OTTHUMG00000131740
Gene type	protein-coding
Map location	2q21.3
Pascal p-value	0.535
Sherlock p-value	0.466
Fetal beta	-0.973
DMG	1 (# studies)
eGene	Myers' cis & trans Meta
Support	CompositeSet Darnell FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	1
GSMA_I	Genome scan meta-analysis	Psr: 0.023
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.02395

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg13588645	2	136289118	R3HDM1		-0.021	0.44	DMG:Nishioka_2013

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs10994209	chr10	61877705	R3HDM1	23518		0.1		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
LINGO3	0.86	0.77
KCNAB1	0.83	0.63
PDE1B	0.82	0.73
PMEPA1	0.82	0.72
SCN4B	0.81	0.71
RASD2	0.81	0.78
ENTPD3	0.81	0.68
HTR1D	0.80	0.65
ANO3	0.80	0.60
LRPAP1	0.79	0.72

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
RPS3AP47	-0.35	-0.52
RPL24	-0.35	-0.54
RPL38	-0.35	-0.59
RPL35A	-0.35	-0.58
RPL34	-0.35	-0.58
RPL5	-0.35	-0.47
RPS6	-0.34	-0.54
RPL27	-0.34	-0.50
RPS8	-0.34	-0.51
RPS24	-0.34	-0.54

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003676	nucleic acid binding	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BIDUS METASTASIS DN	161	93	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
CHOI ATL STAGE PREDICTOR	44	24	All SZGR 2.0 genes in this pathway
RASHI RESPONSE TO IONIZING RADIATION 5	147	89	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN	712	443	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER UP	358	245	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS	988	594	All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION UP	195	138	All SZGR 2.0 genes in this pathway
SMITH TERT TARGETS UP	145	91	All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C8	72	56	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
KAYO AGING MUSCLE DN	123	76	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER POOR SURVIVAL A6	456	285	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS UP	518	299	All SZGR 2.0 genes in this pathway
WANG RECURRENT LIVER CANCER UP	20	13	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA UP	207	143	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA CLASSES UP	605	377	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D	882	506	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-130/301	864	870	m8	hsa-miR-130a^brain	CAGUGCAAUGUUAAAAGGGCAU
				hsa-miR-301	CAGUGCAAUAGUAUUGUCAAAGC
				hsa-miR-130b^brain	CAGUGCAAUGAUGAAAGGGCAU
				hsa-miR-454-3p	UAGUGCAAUAUUGCUUAUAGGGUUU
miR-140	639	645	m8	hsa-miR-140^brain	AGUGGUUUUACCCUAUGGUAG
miR-203.1	169	175	1A	hsa-miR-203	UGAAAUGUUUAGGACCACUAG
miR-30-5p	964	971	1A,m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-381	292	298	m8	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-493-5p	917	923	1A	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-93.hd/291-3p/294/295/302/372/373/520	866	872	1A	hsa-miR-93^brain	AAAGUGCUGUUCGUGCAGGUAG
				hsa-miR-302a	UAAGUGCUUCCAUGUUUUGGUGA
				hsa-miR-302b	UAAGUGCUUCCAUGUUUUAGUAG
				hsa-miR-302c	UAAGUGCUUCCAUGUUUCAGUGG
				hsa-miR-302d	UAAGUGCUUCCAUGUUUGAGUGU
				hsa-miR-372	AAAGUGCUGCGACAUUUGAGCGU
				hsa-miR-373	GAAGUGCUUCGAUUUUGGGGUGU
				hsa-miR-520e	AAAGUGCUUCCUUUUUGAGGG
				hsa-miR-520a	AAAGUGCUUCCCUUUGGACUGU
				hsa-miR-520b	AAAGUGCUUCCUUUUAGAGGG
				hsa-miR-520c	AAAGUGCUUCCUUUUAGAGGGUU
				hsa-miR-520d	AAAGUGCUUCUCUUUGGUGGGUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: R3HDM1