Gene Page: ZZZ3
Summary ?
| GeneID | 26009 |
| Symbol | ZZZ3 |
| Synonyms | ATAC1 |
| Description | zinc finger ZZ-type containing 3 |
| Reference | HGNC:HGNC:24523|Ensembl:ENSG00000036549|HPRD:15907|Vega:OTTHUMG00000009652 |
| Gene type | protein-coding |
| Map location | 1p31.1 |
| Pascal p-value | 0.045 |
| Sherlock p-value | 0.169 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02692 |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| ZZZ3 | chr1 | 78097966 | T | G | NM_015534 | . | silent | Schizophrenia | DNM:Fromer_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MST1 | 0.64 | 0.57 |
| NEIL1 | 0.64 | 0.54 |
| MYO15B | 0.63 | 0.59 |
| KIAA1683 | 0.63 | 0.49 |
| KIAA1984 | 0.63 | 0.47 |
| NBEAL2 | 0.63 | 0.52 |
| PILRB | 0.63 | 0.54 |
| AC022382.1 | 0.63 | 0.48 |
| PLA2G4B | 0.62 | 0.53 |
| DMPK | 0.62 | 0.53 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| SNX3 | -0.35 | -0.36 |
| PIGK | -0.35 | -0.37 |
| C12orf5 | -0.34 | -0.37 |
| DNAJB9 | -0.34 | -0.37 |
| KBTBD3 | -0.34 | -0.40 |
| GMFB | -0.34 | -0.36 |
| PNPLA8 | -0.34 | -0.38 |
| MTMR6 | -0.34 | -0.38 |
| UBE2W | -0.34 | -0.36 |
| ARPP19 | -0.33 | -0.33 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003677 | DNA binding | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
| GO:0006350 | transcription | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KIM WT1 TARGETS DN | 459 | 276 | All SZGR 2.0 genes in this pathway |
| DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER MYC TARGETS REPRESSED BY SERUM | 159 | 93 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
| PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
| JAIN NFKB SIGNALING | 75 | 44 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS EARLY PROGENITOR | 532 | 309 | All SZGR 2.0 genes in this pathway |
| DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP | 314 | 201 | All SZGR 2.0 genes in this pathway |
| RAMALHO STEMNESS UP | 206 | 118 | All SZGR 2.0 genes in this pathway |
| DAZARD RESPONSE TO UV NHEK DN | 318 | 220 | All SZGR 2.0 genes in this pathway |
| DAZARD UV RESPONSE CLUSTER G6 | 153 | 112 | All SZGR 2.0 genes in this pathway |
| CHEN HOXA5 TARGETS 9HR UP | 223 | 132 | All SZGR 2.0 genes in this pathway |
| COLINA TARGETS OF 4EBP1 AND 4EBP2 | 356 | 214 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-128 | 1093 | 1099 | 1A | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
| hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
| miR-186 | 985 | 991 | m8 | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
| miR-27 | 1093 | 1099 | m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
| hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
| miR-338 | 997 | 1003 | 1A | hsa-miR-338brain | UCCAGCAUCAGUGAUUUUGUUGA |
| miR-342 | 1095 | 1101 | 1A | hsa-miR-342brain | UCUCACACAGAAAUCGCACCCGUC |
| miR-34b | 844 | 851 | 1A,m8 | hsa-miR-34b | UAGGCAGUGUCAUUAGCUGAUUG |
| miR-410 | 689 | 696 | 1A,m8 | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
| miR-494 | 1034 | 1040 | m8 | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.