Gene Page: GMFB
Summary ?
GeneID | 2764 |
Symbol | GMFB |
Synonyms | GMF |
Description | glia maturation factor beta |
Reference | MIM:601713|HGNC:HGNC:4373|Ensembl:ENSG00000197045|Vega:OTTHUMG00000140307 |
Gene type | protein-coding |
Map location | 14q22.2 |
Pascal p-value | 0.199 |
Sherlock p-value | 0.274 |
Fetal beta | -0.572 |
DMG | 1 (# studies) |
Support | G2Cdb.human_Synaptosome G2Cdb.humanPSD |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:vanEijk_2014 | Genome-wide DNA methylation analysis | This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). | 1 |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg24256211 | 14 | 55035215 | GMFB | 0.003 | 5.855 | DMG:vanEijk_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MAST1 | 0.91 | 0.94 |
PACS1 | 0.90 | 0.95 |
GPRIN1 | 0.90 | 0.93 |
KIFC3 | 0.90 | 0.89 |
RASGEF1C | 0.90 | 0.90 |
PIK3R2 | 0.89 | 0.93 |
MAPKBP1 | 0.89 | 0.93 |
AC079061.1 | 0.89 | 0.86 |
TMEM63B | 0.89 | 0.94 |
RUSC1 | 0.88 | 0.94 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.31 | -0.70 | -0.82 |
MT-CO2 | -0.70 | -0.82 |
AF347015.27 | -0.70 | -0.81 |
AF347015.33 | -0.68 | -0.79 |
MT-CYB | -0.68 | -0.80 |
S100B | -0.68 | -0.78 |
AF347015.8 | -0.67 | -0.82 |
AC021016.1 | -0.67 | -0.82 |
COPZ2 | -0.67 | -0.76 |
FXYD1 | -0.67 | -0.77 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003779 | actin binding | IEA | - | |
GO:0004871 | signal transducer activity | TAS | 7598724 |8798479 | |
GO:0004860 | protein kinase inhibitor activity | TAS | 8639570 | |
GO:0008083 | growth factor activity | IEA | - | |
GO:0008047 | enzyme activator activity | TAS | 8798479 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 1712830 |
GO:0006468 | protein amino acid phosphorylation | TAS | 7598724 | |
GO:0007165 | signal transduction | TAS | 8798479 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | IEA | - | |
GO:0005634 | nucleus | IDA | 18029348 | |
GO:0005730 | nucleolus | IDA | 18029348 | |
GO:0005739 | mitochondrion | IDA | 18029348 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
WINTER HYPOXIA UP | 92 | 57 | All SZGR 2.0 genes in this pathway |
TURASHVILI BREAST LOBULAR CARCINOMA VS LOBULAR NORMAL DN | 74 | 42 | All SZGR 2.0 genes in this pathway |
GARY CD5 TARGETS DN | 431 | 263 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
GRABARCZYK BCL11B TARGETS UP | 81 | 40 | All SZGR 2.0 genes in this pathway |
HORIUCHI WTAP TARGETS DN | 310 | 188 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR UP | 557 | 331 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP | 633 | 376 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
OUELLET CULTURED OVARIAN CANCER INVASIVE VS LMP UP | 69 | 40 | All SZGR 2.0 genes in this pathway |
CHOI ATL STAGE PREDICTOR | 44 | 24 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
CALVET IRINOTECAN SENSITIVE VS REVERTED UP | 5 | 5 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
WEI MIR34A TARGETS | 148 | 97 | All SZGR 2.0 genes in this pathway |
BALDWIN PRKCI TARGETS UP | 35 | 26 | All SZGR 2.0 genes in this pathway |
GOLDRATH HOMEOSTATIC PROLIFERATION | 171 | 102 | All SZGR 2.0 genes in this pathway |
DER IFN BETA RESPONSE UP | 102 | 67 | All SZGR 2.0 genes in this pathway |
JIANG VHL TARGETS | 138 | 91 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
ZHU CMV ALL UP | 120 | 89 | All SZGR 2.0 genes in this pathway |
TAKAO RESPONSE TO UVB RADIATION DN | 98 | 67 | All SZGR 2.0 genes in this pathway |
ZHU CMV 24 HR UP | 93 | 65 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5 | 482 | 296 | All SZGR 2.0 genes in this pathway |
HILLION HMGA1 TARGETS | 90 | 71 | All SZGR 2.0 genes in this pathway |
HILLION HMGA1B TARGETS | 92 | 68 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER UP | 973 | 570 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP | 863 | 514 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER POOR SURVIVAL A6 | 456 | 285 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
BOYAULT LIVER CANCER SUBCLASS G3 UP | 188 | 121 | All SZGR 2.0 genes in this pathway |
NAKAMURA ADIPOGENESIS LATE UP | 104 | 67 | All SZGR 2.0 genes in this pathway |
JIANG HYPOXIA VIA VHL | 34 | 24 | All SZGR 2.0 genes in this pathway |
BAE BRCA1 TARGETS UP | 75 | 47 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
PASINI SUZ12 TARGETS DN | 315 | 215 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124/506 | 791 | 797 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-132/212 | 88 | 94 | 1A | hsa-miR-212SZ | UAACAGUCUCCAGUCACGGCC |
hsa-miR-132brain | UAACAGUCUACAGCCAUGGUCG | ||||
miR-135 | 2760 | 2766 | 1A | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-145 | 3068 | 3074 | 1A | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU | ||||
miR-148/152 | 85 | 91 | m8 | hsa-miR-148a | UCAGUGCACUACAGAACUUUGU |
hsa-miR-152brain | UCAGUGCAUGACAGAACUUGGG | ||||
hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU | ||||
miR-181 | 3157 | 3163 | 1A | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-182 | 2820 | 2827 | 1A,m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-194 | 89 | 95 | m8 | hsa-miR-194 | UGUAACAGCAACUCCAUGUGGA |
miR-203.1 | 3121 | 3127 | m8 | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
miR-217 | 111 | 117 | 1A | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU |
miR-26 | 3329 | 3336 | 1A,m8 | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
miR-29 | 3562 | 3568 | m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-320 | 807 | 813 | 1A | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
miR-34/449 | 834 | 841 | 1A,m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
miR-375 | 147 | 153 | 1A | hsa-miR-375 | UUUGUUCGUUCGGCUCGCGUGA |
miR-382 | 3095 | 3101 | m8 | hsa-miR-382brain | GAAGUUGUUCGUGGUGGAUUCG |
miR-384 | 2540 | 2546 | 1A | hsa-miR-384 | AUUCCUAGAAAUUGUUCAUA |
miR-490 | 2462 | 2468 | 1A | hsa-miR-490 | CAACCUGGAGGACUCCAUGCUG |
miR-495 | 101 | 107 | m8 | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
miR-96 | 2821 | 2827 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.