SZGR2

Summary ?

GeneID	286
Symbol	ANK1
Synonyms	ANK\|SPH1\|SPH2
Description	ankyrin 1
Reference	MIM:612641\|HGNC:HGNC:492\|Ensembl:ENSG00000029534\|HPRD:01693\|Vega:OTTHUMG00000150281
Gene type	protein-coding
Map location	8p11.1
Pascal p-value	0.416
Fetal beta	-0.789
DMG	1 (# studies)
eGene	Meta
Support	G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS CompositeSet Darnell FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
DNM:Fromer_2014	Whole Exome Sequencing analysis	This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
Expression	Meta-analysis of gene expression	P value: 1.772
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0437

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
ANK1	chr8	41571683	G	C	NM_000037 NM_001142446 NM_020475 NM_020476 NM_020477	p.597S>R p.630S>R p.597S>R p.597S>R p.597S>R	missense missense missense missense missense			Schizophrenia	DNM:Fromer_2014

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg14904662	8	41655673	ANK1	4.679E-4	0.533	0.046	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005200	structural constituent of cytoskeleton	TAS		8640229
GO:0008093	cytoskeletal adaptor activity	TAS		11427698
GO:0030507	spectrin binding	NAS		8640229
GO:0019899	enzyme binding	TAS		11427698
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007010	cytoskeleton organization	NAS		9430667
GO:0007165	signal transduction	IEA		-
GO:0006887	exocytosis	NAS		1833445
GO:0045199	maintenance of epithelial cell apical/basal polarity	TAS		11427698
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005856	cytoskeleton	NAS		1833445
GO:0005737	cytoplasm	IEA		-
GO:0005886	plasma membrane	NAS		9430667
GO:0016323	basolateral plasma membrane	NAS		12409278
GO:0016529	sarcoplasmic reticulum	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
L1CAM	CAML1 \| CD171 \| HSAS \| HSAS1 \| MASA \| MIC5 \| N-CAML1 \| S10 \| SPG1	L1 cell adhesion molecule	-	HPRD,BioGRID	11222639
NBPF3	AE2 \| DKFZp434D177	neuroblastoma breakpoint family, member 3	-	HPRD	9587054
OBSCN	DKFZp666E245 \| FLJ14124 \| KIAA1556 \| KIAA1639 \| MGC120409 \| MGC120410 \| MGC120411 \| MGC120412 \| MGC138590 \| UNC89	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	-	HPRD,BioGRID	12527750 \|12631729
RHAG	CD241 \| RH2 \| RH50A \| Rh50 \| Rh50GP \| SLC42A1	Rh-associated glycoprotein	-	HPRD,BioGRID	12719424
SLC4A1	AE1 \| BND3 \| CD233 \| DI \| EMPB3 \| EPB3 \| FR \| MGC116750 \| MGC116753 \| MGC126619 \| MGC126623 \| RTA1A \| SW \| WD \| WD1 \| WR	solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)	-	HPRD	6449514
SLC4A1	AE1 \| BND3 \| CD233 \| DI \| EMPB3 \| EPB3 \| FR \| MGC116750 \| MGC116753 \| MGC126619 \| MGC126623 \| RTA1A \| SW \| WD \| WD1 \| WR	solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)	Affinity Capture-Western	BioGRID	8227202
SLC4A3	AE3 \| SLC2C	solute carrier family 4, anion exchanger, member 3	-	HPRD,BioGRID	8227202
SPTA1	EL2 \| SPTA	spectrin, alpha, erythrocytic 1 (elliptocytosis 2)	Reconstituted Complex	BioGRID	2971657
SPTAN1	(ALPHA)II-SPECTRIN \| FLJ44613 \| NEAS	spectrin, alpha, non-erythrocytic 1 (alpha-fodrin)	-	HPRD	492324 \|2141335 \|2970468 \|2971657
SPTB	HSpTB1	spectrin, beta, erythrocytic	Reconstituted Complex	BioGRID	2141335
TIAM1	FLJ36302	T-cell lymphoma invasion and metastasis 1	-	HPRD,BioGRID	10893266
TTN	CMD1G \| CMH9 \| CMPD4 \| CONNECTIN \| DKFZp451N061 \| EOMFC \| FLJ26020 \| FLJ26409 \| FLJ32040 \| FLJ34413 \| FLJ39564 \| FLJ43066 \| HMERF \| LGMD2J \| TMD	titin	-	HPRD,BioGRID	12444090

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
REACTOME DEVELOPMENTAL BIOLOGY	396	292	All SZGR 2.0 genes in this pathway
REACTOME AXON GUIDANCE	251	188	All SZGR 2.0 genes in this pathway
REACTOME L1CAM INTERACTIONS	86	62	All SZGR 2.0 genes in this pathway
REACTOME INTERACTION BETWEEN L1 AND ANKYRINS	23	19	All SZGR 2.0 genes in this pathway
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN	493	298	All SZGR 2.0 genes in this pathway
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP	255	177	All SZGR 2.0 genes in this pathway
DAVICIONI RHABDOMYOSARCOMA PAX FOXO1 FUSION UP	64	37	All SZGR 2.0 genes in this pathway
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA UP	368	234	All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC DN	187	115	All SZGR 2.0 genes in this pathway
KERLEY RESPONSE TO CISPLATIN UP	44	30	All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION	77	51	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP	1037	673	All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 8P12 P11 AMPLICON	57	32	All SZGR 2.0 genes in this pathway
NIKOLSKY MUTATED AND AMPLIFIED IN BREAST CANCER	94	60	All SZGR 2.0 genes in this pathway
WELCH GATA1 TARGETS	22	12	All SZGR 2.0 genes in this pathway
ROSS AML OF FAB M7 TYPE	68	44	All SZGR 2.0 genes in this pathway
SCHURINGA STAT5A TARGETS UP	21	13	All SZGR 2.0 genes in this pathway
ALCALAY AML BY NPM1 LOCALIZATION DN	184	132	All SZGR 2.0 genes in this pathway
CHIBA RESPONSE TO TSA UP	52	33	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN	504	323	All SZGR 2.0 genes in this pathway
MONNIER POSTRADIATION TUMOR ESCAPE DN	373	196	All SZGR 2.0 genes in this pathway
ACEVEDO METHYLATED IN LIVER CANCER DN	940	425	All SZGR 2.0 genes in this pathway
VALK AML CLUSTER 7	28	16	All SZGR 2.0 genes in this pathway
VALK AML CLUSTER 8	26	17	All SZGR 2.0 genes in this pathway
YOSHIOKA LIVER CANCER EARLY RECURRENCE UP	40	23	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2	491	319	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME2	17	11	All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3	435	318	All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS DN	242	146	All SZGR 2.0 genes in this pathway
BAKKER FOXO3 TARGETS DN	187	109	All SZGR 2.0 genes in this pathway
YANG BCL3 TARGETS UP	364	236	All SZGR 2.0 genes in this pathway
STEINER ERYTHROCYTE MEMBRANE GENES	15	10	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY	1725	838	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-103/107	2299	2306	1A,m8	hsa-miR-103^brain	AGCAGCAUUGUACAGGGCUAUGA
miR-103/107	2299	2306	1A,m8	hsa-miR-107^brain	AGCAGCAUUGUACAGGGCUAUCA
miR-124.1	1482	1488	1A	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-128	631	637	1A	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	631	637	1A	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-138	899	906	1A,m8	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-138	899	906	1A,m8	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-139	137	144	1A,m8	hsa-miR-139^brain	UCUACAGUGCACGUGUCU
miR-153	1015	1022	1A,m8	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-218	1526	1532	1A	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-27	631	637	m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	631	637	m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-328	1564	1570	m8	hsa-miR-328^brain	CUGGCCCUCUCUGCCCUUCCGU
miR-448	1016	1022	1A	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-452	1018	1024	m8	hsa-miR-452	UGUUUGCAGAGGAAACUGAGAC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: ANK1