Gene Page: GRID1
Summary ?
GeneID | 2894 |
Symbol | GRID1 |
Synonyms | GluD1 |
Description | glutamate ionotropic receptor delta type subunit 1 |
Reference | MIM:610659|HGNC:HGNC:4575|Ensembl:ENSG00000182771|HPRD:17078|Vega:OTTHUMG00000018650 |
Gene type | protein-coding |
Map location | 10q22 |
Pascal p-value | 0.005 |
Fetal beta | -0.811 |
DMG | 1 (# studies) |
eGene | Meta |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Association | A combined odds ratio method (Sun et al. 2008), association studies | 2 | Link to SZGene |
Expression | Meta-analysis of gene expression | P value: 1.428 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenics,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 3 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg01007305 | 10 | 88123687 | GRID1 | 6.023E-4 | 0.296 | 0.05 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
SPOCK1 | 0.80 | 0.87 |
MTMR7 | 0.80 | 0.86 |
PALM2-AKAP2 | 0.79 | 0.82 |
AHNAK2 | 0.77 | 0.83 |
SLC23A2 | 0.77 | 0.86 |
NLGN4X | 0.77 | 0.83 |
CADPS | 0.77 | 0.87 |
TNFRSF21 | 0.76 | 0.84 |
GABBR2 | 0.76 | 0.86 |
NRG3 | 0.76 | 0.88 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
SAT1 | -0.48 | -0.64 |
ACSF2 | -0.48 | -0.60 |
AP002478.3 | -0.47 | -0.63 |
AC021016.1 | -0.47 | -0.58 |
HIGD1B | -0.46 | -0.61 |
FXYD1 | -0.46 | -0.55 |
C1orf54 | -0.45 | -0.64 |
AF347015.31 | -0.45 | -0.58 |
GNG11 | -0.45 | -0.60 |
AF347015.2 | -0.45 | -0.54 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004970 | ionotropic glutamate receptor activity | IEA | glutamate (GO term level: 7) | - |
GO:0005234 | extracellular-glutamate-gated ion channel activity | IEA | glutamate (GO term level: 11) | - |
GO:0004872 | receptor activity | IEA | - | |
GO:0005515 | protein binding | IEA | - | |
GO:0005216 | ion channel activity | IEA | - | |
GO:0016491 | oxidoreductase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0008152 | metabolic process | IEA | - | |
GO:0006811 | ion transport | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0045211 | postsynaptic membrane | IEA | Synap, Neurotransmitter (GO term level: 5) | - |
GO:0045202 | synapse | IEA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
GO:0016021 | integral to membrane | IEA | - | |
GO:0005886 | plasma membrane | IEA | - | |
GO:0030054 | cell junction | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION | 272 | 195 | All SZGR 2.0 genes in this pathway |
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION UP | 119 | 66 | All SZGR 2.0 genes in this pathway |
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
SILIGAN BOUND BY EWS FLT1 FUSION | 47 | 34 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
ACEVEDO METHYLATED IN LIVER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124.1 | 2172 | 2178 | m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-124/506 | 2663 | 2669 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA | ||||
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-136 | 156 | 162 | m8 | hsa-miR-136 | ACUCCAUUUGUUUUGAUGAUGGA |
miR-138 | 41 | 47 | 1A | hsa-miR-138brain | AGCUGGUGUUGUGAAUC |
miR-181 | 2584 | 2590 | 1A | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-182 | 293 | 299 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-330 | 2602 | 2608 | m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
miR-34/449 | 2169 | 2175 | m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
miR-34b | 2170 | 2176 | m8 | hsa-miR-34b | UAGGCAGUGUCAUUAGCUGAUUG |
miR-485-3p | 224 | 231 | 1A,m8 | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
miR-96 | 292 | 299 | 1A,m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.