SZGR2

Summary ?

GeneID	2908
Symbol	NR3C1
Synonyms	GCCR\|GCR\|GCRST\|GR\|GRL
Description	nuclear receptor subfamily 3 group C member 1
Reference	MIM:138040\|HGNC:HGNC:7978\|Ensembl:ENSG00000113580\|HPRD:00679\|Vega:OTTHUMG00000129677
Gene type	protein-coding
Map location	5q31.3
Pascal p-value	0.068
Fetal beta	-2.483
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I	Genome scan meta-analysis	Psr: 0.0032
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.00459
GSMA_IIE	Genome scan meta-analysis (European-ancestry samples)	Psr: 0.01718
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.1127

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg18146873	5	142782827	NR3C1	2.4E-8	-0.017	7.84E-6	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs2407038	chr8	3588530	NR3C1	2908		0.18		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MYRIP	0.77	0.77
RAPGEFL1	0.73	0.76
IQSEC2	0.73	0.74
GARNL4	0.72	0.73
LRRK1	0.72	0.71
KIAA1045	0.72	0.74
PITPNM3	0.72	0.74
GDA	0.71	0.75
PITPNM2	0.71	0.73
AJAP1	0.70	0.70

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
BCL7C	-0.36	-0.40
UXT	-0.35	-0.31
SNRPG	-0.34	-0.39
RPL35	-0.34	-0.38
RPS12	-0.34	-0.39
C21orf57	-0.34	-0.36
RPL27	-0.34	-0.32
RPL24	-0.34	-0.31
RPL37	-0.33	-0.41
RPS27A	-0.33	-0.35

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004883	glucocorticoid receptor activity	TAS		8621628
GO:0003700	transcription factor activity	TAS		7769088 \|10903900
GO:0005496	steroid binding	IEA		-
GO:0005515	protein binding	IPI		9079630 \|10364267 \|11266503 \|12773562
GO:0008270	zinc ion binding	IEA		-
GO:0046872	metal ion binding	IEA		-
GO:0043565	sequence-specific DNA binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006366	transcription from RNA polymerase II promoter	TAS		8621628
GO:0007165	signal transduction	TAS		7769088
GO:0007530	sex determination	IEA		-
GO:0016568	chromatin modification	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	TAS		9873044
GO:0005730	nucleolus	IDA		18029348
GO:0005737	cytoplasm	TAS		9873044
GO:0005759	mitochondrial matrix	TAS		10887960

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ADA	-	adenosine deaminase	-	HPRD,BioGRID	9154805
AR	AIS \| DHTR \| HUMARA \| KD \| NR3C4 \| SBMA \| SMAX1 \| TFM	androgen receptor	-	HPRD,BioGRID	9162033
ARPC5	ARC16 \| MGC88523 \| dJ127C7.3 \| p16-Arc	actin related protein 2/3 complex, subunit 5, 16kDa	Two-hybrid	BioGRID	10508170
BAG1	RAP46	BCL2-associated athanogene	-	HPRD,BioGRID	11101523
CALR	CRT \| FLJ26680 \| RO \| SSA \| cC1qR	calreticulin	-	HPRD,BioGRID	8107808 \|9089287
CEBPA	C/EBP-alpha \| CEBP	CCAAT/enhancer binding protein (C/EBP), alpha	Reconstituted Complex	BioGRID	9817600
CEBPA	C/EBP-alpha \| CEBP	CCAAT/enhancer binding protein (C/EBP), alpha	-	HPRD	11818365
CEBPB	C/EBP-beta \| CRP2 \| IL6DBP \| LAP \| MGC32080 \| NF-IL6 \| TCF5	CCAAT/enhancer binding protein (C/EBP), beta	-	HPRD,BioGRID	9817600
COPS6	CSN6 \| MOV34-34KD	COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis)	-	HPRD	12237292
CREB1	CREB \| MGC9284	cAMP responsive element binding protein 1	-	HPRD,BioGRID	7621901 \|8449898
CREBBP	CBP \| KAT3A \| RSTS	CREB binding protein	-	HPRD,BioGRID	9649342
DAP3	DAP-3 \| DKFZp686G12159 \| MGC126058 \| MGC126059 \| MRP-S29 \| MRPS29 \| bMRP-10	death associated protein 3	-	HPRD,BioGRID	10903152 \|12099703
DAXX	BING2 \| DAP6 \| EAP1 \| MGC126245 \| MGC126246	death-domain associated protein	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	12595526
DDC	AADC	dopa decarboxylase (aromatic L-amino acid decarboxylase)	Reconstituted Complex	BioGRID	12864730
DDX54	DP97 \| MGC2835	DEAD (Asp-Glu-Ala-Asp) box polypeptide 54	-	HPRD,BioGRID	12466272
ECD	GCR2 \| HSGT1	ecdysoneless homolog (Drosophila)	-	HPRD,BioGRID	9928932
ETS1	ETS-1 \| EWSR2 \| FLJ10768	v-ets erythroblastosis virus E26 oncogene homolog 1 (avian)	-	HPRD	11279115
ETS2	ETS2IT1	v-ets erythroblastosis virus E26 oncogene homolog 2 (avian)	-	HPRD,BioGRID	11279115
FKBP4	FKBP52 \| FKBP59 \| HBI \| Hsp56 \| PPIase \| p52	FK506 binding protein 4, 59kDa	-	HPRD,BioGRID	8341706
HMGB1	DKFZp686A04236 \| HMG1 \| HMG3 \| SBP-1	high-mobility group box 1	Reconstituted Complex	BioGRID	9671457
HMGB2	HMG2	high-mobility group box 2	Reconstituted Complex	BioGRID	9671457
HNRNPU	HNRPU \| SAF-A \| U21.1	heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)	-	HPRD,BioGRID	9353307
HOXB1	HOX2 \| HOX2I \| Hox-2.9 \| MGC116843 \| MGC116844 \| MGC116845	homeobox B1	-	HPRD,BioGRID	12487626
HSP90AA1	FLJ31884 \| HSP86 \| HSP89A \| HSP90A \| HSP90N \| HSPC1 \| HSPCA \| HSPCAL1 \| HSPCAL4 \| HSPN \| Hsp89 \| Hsp90 \| LAP2	heat shock protein 90kDa alpha (cytosolic), class A member 1	-	HPRD,BioGRID	8621522 \|8645634 \|8898375 \|9334248 \|10066374
HSPA1A	FLJ54303 \| FLJ54370 \| FLJ54392 \| FLJ54408 \| FLJ75127 \| HSP70-1 \| HSP70-1A \| HSP70I \| HSP72 \| HSPA1 \| HSPA1B	heat shock 70kDa protein 1A	-	HPRD,BioGRID	12093808
HSPD1	CPN60 \| GROEL \| HSP60 \| HSP65 \| HuCHA60 \| SPG13	heat shock 60kDa protein 1 (chaperonin)	Two-hybrid	BioGRID	10508170
IDE	FLJ35968 \| INSULYSIN	insulin-degrading enzyme	-	HPRD	8051160
IL1RN	ICIL-1RA \| IL-1ra3 \| IL1F3 \| IL1RA \| IRAP \| MGC10430	interleukin 1 receptor antagonist	-	HPRD	10948677
JARID1A	KDM5A \| RBBP2 \| RBP2	jumonji, AT rich interactive domain 1A	Reconstituted Complex	BioGRID	11358960
JARID1A	KDM5A \| RBBP2 \| RBP2	jumonji, AT rich interactive domain 1A	Rbp2 interacts with GR. This interaction was modeled on a demonstrated interaction between human Rbp2 and rat GR.	BIND	11358960
JUN	AP-1 \| AP1 \| c-Jun	jun oncogene	-	HPRD	7823959 \|8733011
JUN	AP-1 \| AP1 \| c-Jun	jun oncogene	Reconstituted Complex	BioGRID	14522952
MED1	CRSP1 \| CRSP200 \| DRIP205 \| DRIP230 \| MGC71488 \| PBP \| PPARBP \| PPARGBP \| RB18A \| TRAP220 \| TRIP2	mediator complex subunit 1	Reconstituted Complex	BioGRID	10508170 \|11266503
MED14	CRSP150 \| CRSP2 \| CSRP \| CXorf4 \| DRIP150 \| EXLM1 \| MGC104513 \| RGR1 \| TRAP170	mediator complex subunit 14	-	HPRD,BioGRID	10508170
NCL	C23 \| FLJ45706	nucleolin	-	HPRD,BioGRID	8530516 \|11162542
NCOA1	F-SRC-1 \| KAT13A \| MGC129719 \| MGC129720 \| NCoA-1 \| RIP160 \| SRC-1 \| SRC1 \| bHLHe42	nuclear receptor coactivator 1	-	HPRD	12118039 \|12569182 \|12917342
NCOA1	F-SRC-1 \| KAT13A \| MGC129719 \| MGC129720 \| NCoA-1 \| RIP160 \| SRC-1 \| SRC1 \| bHLHe42	nuclear receptor coactivator 1	in vitro Reconstituted Complex Two-hybrid	BioGRID	11266503 \|12118039
NCOA2	GRIP1 \| KAT13C \| MGC138808 \| NCoA-2 \| TIF2	nuclear receptor coactivator 2	-	HPRD,BioGRID	12151000
NCOA2	GRIP1 \| KAT13C \| MGC138808 \| NCoA-2 \| TIF2	nuclear receptor coactivator 2	GR-alpha interacts with GRIP1.	BIND	11704662
NCOA3	ACTR \| AIB-1 \| AIB1 \| CAGH16 \| CTG26 \| KAT13B \| MGC141848 \| RAC3 \| SRC3 \| TNRC14 \| TNRC16 \| TRAM-1 \| pCIP	nuclear receptor coactivator 3	Affinity Capture-Western Reconstituted Complex	BioGRID	11266503 \|12917342
NCOA4	ARA70 \| DKFZp762E1112 \| ELE1 \| PTC3 \| RFG	nuclear receptor coactivator 4	Two-hybrid	BioGRID	10517667
NCOA6	AIB3 \| ANTP \| ASC2 \| HOX1.1 \| HOXA7 \| KIAA0181 \| NRC \| PRIP \| RAP250 \| TRBP	nuclear receptor coactivator 6	-	HPRD,BioGRID	10567404
NCOR1	KIAA1047 \| MGC104216 \| N-CoR \| TRAC1 \| hCIT529I10 \| hN-CoR	nuclear receptor co-repressor 1	-	HPRD,BioGRID	12011091
NCOR2	CTG26 \| SMRT \| SMRTE \| SMRTE-tau \| TNRC14 \| TRAC-1 \| TRAC1	nuclear receptor co-repressor 2	-	HPRD,BioGRID	12011091
NEDD4L	FLJ33870 \| KIAA0439 \| NEDD4-2 \| RSP5 \| hNedd4-2	neural precursor cell expressed, developmentally down-regulated 4-like	Reconstituted Complex	BioGRID	9649342
NFKB1	DKFZp686C01211 \| EBP-1 \| KBF1 \| MGC54151 \| NF-kappa-B \| NFKB-p105 \| NFKB-p50 \| p105	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	-	HPRD,BioGRID	7823959 \|8290595
NFKB2	LYT-10 \| LYT10	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	-	HPRD,BioGRID	7823959
NR2F6	EAR-2 \| EAR2 \| ERBAL2	nuclear receptor subfamily 2, group F, member 6	-	HPRD,BioGRID	10713182
NR3C1	GCCR \| GCR \| GR \| GRL	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	Co-crystal Structure	BioGRID	12151000
NR3C2	MCR \| MGC133092 \| MLR \| MR	nuclear receptor subfamily 3, group C, member 2	-	HPRD,BioGRID	11154266
NRIP1	FLJ77253 \| RIP140	nuclear receptor interacting protein 1	Affinity Capture-Western Reconstituted Complex	BioGRID	10364267 \|11266503 \|12773562
NRIP1	FLJ77253 \| RIP140	nuclear receptor interacting protein 1	-	HPRD	10364267 \|12773562
ONECUT1	HNF-6 \| HNF6 \| HNF6A	one cut homeobox 1	-	HPRD,BioGRID	10430878
PBX1	DKFZp686B09108 \| MGC126627	pre-B-cell leukemia homeobox 1	Affinity Capture-Western	BioGRID	12487626
PELP1	HMX3 \| MNAR \| P160	proline, glutamate and leucine rich protein 1	-	HPRD,BioGRID	12415108
PIAS2	MGC102682 \| MIZ1 \| PIASX \| PIASX-ALPHA \| PIASX-BETA \| SIZ2 \| ZMIZ4 \| miz	protein inhibitor of activated STAT, 2	Reconstituted Complex	BioGRID	11117529
POU1F1	GHF-1 \| PIT1 \| Pit-1	POU class 1 homeobox 1	-	HPRD,BioGRID	9426156
POU2F1	OCT1 \| OTF1	POU class 2 homeobox 1	-	HPRD,BioGRID	9584182 \|10480874 \|10490647 \|14522952
POU2F2	OCT2 \| OTF2 \| Oct-2	POU class 2 homeobox 2	-	HPRD,BioGRID	9584182 \|10480874 \|10490647
PPARGC1A	LEM6 \| PGC-1(alpha) \| PGC-1v \| PGC1 \| PGC1A \| PPARGC1	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	-	HPRD,BioGRID	10713165
PRPF6	ANT-1 \| C20orf14 \| TOM \| U5-102K \| hPrp6	PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae)	-	HPRD	12039962
PSMC3IP	GT198 \| HOP2 \| HUMGT198A \| TBPIP	PSMC3 interacting protein	-	HPRD,BioGRID	11739747
PTGES3	P23 \| TEBP \| cPGES	prostaglandin E synthase 3 (cytosolic)	-	HPRD,BioGRID	10691735
PTMS	ParaT	parathymosin	-	HPRD	10601862
RAD9A	RAD9	RAD9 homolog A (S. pombe)	Reconstituted Complex	BioGRID	14966297
RAF1	CRAF \| NS5 \| Raf-1 \| c-Raf	v-raf-1 murine leukemia viral oncogene homolog 1	-	HPRD,BioGRID	11005817
RAN	ARA24 \| Gsp1 \| TC4	RAN, member RAS oncogene family	Two-hybrid	BioGRID	10508170
RANBP9	RANBPM	RAN binding protein 9	Affinity Capture-Western Two-hybrid	BioGRID	12361945
RELA	MGC131774 \| NFKB3 \| p65	v-rel reticuloendotheliosis viral oncogene homolog A (avian)	Affinity Capture-Western in vitro in vivo	BioGRID	7659084 \|8290595 \|10995388
RELA	MGC131774 \| NFKB3 \| p65	v-rel reticuloendotheliosis viral oncogene homolog A (avian)	-	HPRD	7659084 \|10995388
SELENBP1	FLJ13813 \| LPSB \| SP56 \| hSBP \| hSP56	selenium binding protein 1	-	HPRD	8157642
SFN	YWHAS	stratifin	-	HPRD,BioGRID	12730237
SLC25A4	AAC1 \| ANT \| ANT1 \| PEO2 \| PEO3 \| T1	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4	-	HPRD	12039962
SMAD3	DKFZp586N0721 \| DKFZp686J10186 \| HSPC193 \| HsT17436 \| JV15-2 \| MADH3 \| MGC60396	SMAD family member 3	-	HPRD,BioGRID	10518526 \|12902338
SMARCA2	BAF190 \| BRM \| FLJ36757 \| MGC74511 \| SNF2 \| SNF2L2 \| SNF2LA \| SWI2 \| Sth1p \| hBRM \| hSNF2a	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	-	HPRD,BioGRID	8223438
SMARCA4	BAF190 \| BRG1 \| FLJ39786 \| SNF2 \| SNF2-BETA \| SNF2L4 \| SNF2LB \| SWI2 \| hSNF2b	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	Affinity Capture-Western Reconstituted Complex	BioGRID	10688647 \|12917342
SMARCB1	BAF47 \| INI1 \| RDT \| SNF5 \| SNF5L1 \| Sfh1p \| Snr1 \| hSNFS	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	-	HPRD	10688647
SMARCC1	BAF155 \| CRACC1 \| Rsc8 \| SRG3 \| SWI3	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1	Affinity Capture-Western	BioGRID	12917342
SMARCD1	BAF60A \| CRACD1 \| Rsc6p	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1	-	HPRD,BioGRID	12917342
SMARCE1	BAF57	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1	-	HPRD,BioGRID	12917342
STAT3	APRF \| FLJ20882 \| HIES \| MGC16063	signal transducer and activator of transcription 3 (acute-phase response factor)	-	HPRD,BioGRID	9388192 \|14522952
STAT5A	MGF \| STAT5	signal transducer and activator of transcription 5A	-	HPRD	9528750
STAT5B	STAT5	signal transducer and activator of transcription 5B	-	HPRD,BioGRID	8878484 \|9528750 \|11158330
SUMO1	DAP-1 \| GMP1 \| OFC10 \| PIC1 \| SENP2 \| SMT3 \| SMT3C \| SMT3H3 \| SUMO-1 \| UBL1	SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)	-	HPRD	12193561
SVIL	DKFZp686A17191	supervillin	Two-hybrid	BioGRID	11792840
TADA2L	ADA2 \| ADA2A \| FLJ12705 \| KL04P \| hADA2	transcriptional adaptor 2 (ADA2 homolog, yeast)-like	Reconstituted Complex	BioGRID	9649342
TBP	GTF2D \| GTF2D1 \| MGC117320 \| MGC126054 \| MGC126055 \| SCA17 \| TFIID	TATA box binding protein	-	HPRD,BioGRID	9649342
TDG	-	thymine-DNA glycosylase	Reconstituted Complex	BioGRID	12874288
TGFB1I1	ARA55 \| HIC-5 \| HIC5 \| TSC-5	transforming growth factor beta 1 induced transcript 1	-	HPRD,BioGRID	10848625
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	-	HPRD,BioGRID	11080152
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	p53 interacts with GR. This interaction was modelled on a demonstrated interaction between p53 from an unspecified species and GR from an unspecified species.	BIND	9215863
TRIM24	PTC6 \| RNF82 \| TF1A \| TIF1 \| TIF1A \| TIF1ALPHA \| hTIF1	tripartite motif-containing 24	-	HPRD,BioGRID	9115274
TRIM28	FLJ29029 \| KAP1 \| RNF96 \| TF1B \| TIF1B	tripartite motif-containing 28	-	HPRD,BioGRID	9742105
TSG101	TSG10 \| VPS23	tumor susceptibility gene 101	-	HPRD,BioGRID	10508170
TXN	DKFZp686B1993 \| MGC61975 \| TRX \| TRX1	thioredoxin	-	HPRD,BioGRID	9915858
UBE2I	C358B7.1 \| P18 \| UBC9	ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)	-	HPRD	11812797
YWHAH	YWHA1	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide	-	HPRD,BioGRID	9079630 \|11266503 \|12730237
ZBTB16	PLZF \| ZNF145	zinc finger and BTB domain containing 16	-	HPRD,BioGRID	14521715

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION	272	195	All SZGR 2.0 genes in this pathway
BIOCARTA GCR PATHWAY	22	17	All SZGR 2.0 genes in this pathway
BIOCARTA NTHI PATHWAY	24	20	All SZGR 2.0 genes in this pathway
PID SMAD2 3NUCLEAR PATHWAY	82	63	All SZGR 2.0 genes in this pathway
PID HDAC CLASSII PATHWAY	34	27	All SZGR 2.0 genes in this pathway
PID HNF3B PATHWAY	45	37	All SZGR 2.0 genes in this pathway
PID REG GR PATHWAY	82	60	All SZGR 2.0 genes in this pathway
PID AR TF PATHWAY	53	38	All SZGR 2.0 genes in this pathway
PID AP1 PATHWAY	70	60	All SZGR 2.0 genes in this pathway
REACTOME BMAL1 CLOCK NPAS2 ACTIVATES CIRCADIAN EXPRESSION	36	27	All SZGR 2.0 genes in this pathway
REACTOME GENERIC TRANSCRIPTION PATHWAY	352	181	All SZGR 2.0 genes in this pathway
REACTOME NUCLEAR RECEPTOR TRANSCRIPTION PATHWAY	49	36	All SZGR 2.0 genes in this pathway
REACTOME CIRCADIAN CLOCK	53	40	All SZGR 2.0 genes in this pathway
HOLLMANN APOPTOSIS VIA CD40 UP	201	125	All SZGR 2.0 genes in this pathway
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP	255	177	All SZGR 2.0 genes in this pathway
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN	463	290	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL DN	455	304	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN	460	312	All SZGR 2.0 genes in this pathway
HORIUCHI WTAP TARGETS UP	306	188	All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY DN	367	220	All SZGR 2.0 genes in this pathway
SABATES COLORECTAL ADENOMA DN	291	176	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS UP	214	155	All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA UP	171	112	All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA BY DMOG UP	130	85	All SZGR 2.0 genes in this pathway
ELVIDGE HIF1A TARGETS DN	91	58	All SZGR 2.0 genes in this pathway
CHEBOTAEV GR TARGETS UP	77	62	All SZGR 2.0 genes in this pathway
VANHARANTA UTERINE FIBROID DN	67	45	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS A UP	191	128	All SZGR 2.0 genes in this pathway
BUSA SAM68 TARGETS UP	7	6	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
WANG HCP PROSTATE CANCER	111	69	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
INGRAM SHH TARGETS UP	127	79	All SZGR 2.0 genes in this pathway
GUENTHER GROWTH SPHERICAL VS ADHERENT DN	26	19	All SZGR 2.0 genes in this pathway
WOTTON RUNX TARGETS DN	29	18	All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES	648	385	All SZGR 2.0 genes in this pathway
ROZANOV MMP14 TARGETS SUBSET	33	20	All SZGR 2.0 genes in this pathway
ROZANOV MMP14 CORRELATED	11	9	All SZGR 2.0 genes in this pathway
ROZANOV MMP14 TARGETS UP	266	171	All SZGR 2.0 genes in this pathway
BYSTROEM CORRELATED WITH IL5 DN	64	47	All SZGR 2.0 genes in this pathway
PENG GLUTAMINE DEPRIVATION UP	38	25	All SZGR 2.0 genes in this pathway
GRANDVAUX IRF3 TARGETS UP	15	12	All SZGR 2.0 genes in this pathway
LI WILMS TUMOR VS FETAL KIDNEY 1 UP	182	119	All SZGR 2.0 genes in this pathway
ZHAN V2 LATE DIFFERENTIATION GENES	45	34	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS MATURE CELL	293	160	All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP	314	201	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 10HR DN	56	37	All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C2	54	39	All SZGR 2.0 genes in this pathway
LEONARD HYPOXIA	47	35	All SZGR 2.0 genes in this pathway
ZHU CMV 8 HR DN	53	40	All SZGR 2.0 genes in this pathway
ZHU CMV 24 HR DN	91	64	All SZGR 2.0 genes in this pathway
GENTILE UV RESPONSE CLUSTER D7	40	21	All SZGR 2.0 genes in this pathway
GENTILE UV HIGH DOSE DN	312	203	All SZGR 2.0 genes in this pathway
WELCSH BRCA1 TARGETS UP	198	132	All SZGR 2.0 genes in this pathway
ZHU CMV ALL DN	128	93	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK DN	318	220	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 11	57	40	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN	434	302	All SZGR 2.0 genes in this pathway
DAZARD UV RESPONSE CLUSTER G6	153	112	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 6HR DN	160	101	All SZGR 2.0 genes in this pathway
BILD CTNNB1 ONCOGENIC SIGNATURE	82	52	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP	953	554	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP	783	442	All SZGR 2.0 genes in this pathway
LOPES METHYLATED IN COLON CANCER DN	28	26	All SZGR 2.0 genes in this pathway
ZHENG FOXP3 TARGETS IN THYMUS UP	196	137	All SZGR 2.0 genes in this pathway
FOSTER TOLERANT MACROPHAGE DN	409	268	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS SILENCED BY METHYLATION DN	281	179	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP	673	430	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP	602	364	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP	601	369	All SZGR 2.0 genes in this pathway
AMBROSINI FLAVOPIRIDOL TREATMENT TP53	109	63	All SZGR 2.0 genes in this pathway
GRADE COLON AND RECTAL CANCER DN	101	65	All SZGR 2.0 genes in this pathway
WINTER HYPOXIA METAGENE	242	168	All SZGR 2.0 genes in this pathway
WANG TUMOR INVASIVENESS UP	374	247	All SZGR 2.0 genes in this pathway
MOOTHA HUMAN MITODB 6 2002	429	260	All SZGR 2.0 genes in this pathway
MOOTHA MITOCHONDRIA	447	277	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A4	196	124	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS DN	442	275	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS UP	518	299	All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION	422	277	All SZGR 2.0 genes in this pathway
YAGI AML WITH 11Q23 REARRANGED	351	238	All SZGR 2.0 genes in this pathway
ZEMBUTSU SENSITIVITY TO VINBLASTINE	18	12	All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE G2	182	102	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 6HR DN	91	56	All SZGR 2.0 genes in this pathway
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 UP	134	85	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 2 DN	336	211	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP A	898	516	All SZGR 2.0 genes in this pathway
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN	229	135	All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN	321	200	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 UP	344	215	All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A	770	480	All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE VIA P38 COMPLETE	227	151	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124.1	2	9	1A,m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124.1	2	9	1A,m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	20	26	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
				hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
				hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-142-3p	135	141	1A	hsa-miR-142-3p	UGUAGUGUUUCCUACUUUAUGGA
miR-142-5p	531	537	1A	hsa-miR-142-5p	CAUAAAGUAGAAAGCACUAC
miR-18	1378	1385	1A,m8	hsa-miR-18a	UAAGGUGCAUCUAGUGCAGAUA
miR-18	1378	1385	1A,m8	hsa-miR-18b	UAAGGUGCAUCUAGUGCAGUUA
miR-181	2254	2260	m8	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-183	1287	1294	1A,m8	hsa-miR-183	UAUGGCACUGGUAGAAUUCACUG
miR-200bc/429	739	745	m8	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-204/211	480	487	1A,m8	hsa-miR-204^brain	UUCCCUUUGUCAUCCUAUGCCU
				hsa-miR-211	UUCCCUUUGUCAUCCUUCGCCU
				hsa-miR-204^brain	UUCCCUUUGUCAUCCUAUGCCU
				hsa-miR-211	UUCCCUUUGUCAUCCUUCGCCU
miR-218	2501	2507	m8	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-22	611	618	1A,m8	hsa-miR-22^brain	AAGCUGCCAGUUGAAGAACUGU
miR-30-3p	1480	1487	1A,m8	hsa-miR-30a-3p	CUUUCAGUCGGAUGUUUGCAGC
miR-30-3p	1480	1487	1A,m8	hsa-miR-30e-3p	CUUUCAGUCGGAUGUUUACAGC
miR-30-5p	460	466	1A	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-328	154	161	1A,m8	hsa-miR-328^brain	CUGGCCCUCUCUGCCCUUCCGU
miR-377	663	670	1A,m8	hsa-miR-377	AUCACACAAAGGCAACUUUUGU
miR-410	1687	1694	1A,m8	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-496	2135	2141	1A	hsa-miR-496	AUUACAUGGCCAAUCUC
miR-543	2255	2262	1A,m8	hsa-miR-543	AAACAUUCGCGGUGCACUUCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: NR3C1