Gene Page: PACSIN1

Summary
GeneID  29993
Symbol  PACSIN1
Synonyms  KIAA1379|SDPI
Description  protein kinase C and casein kinase substrate in neurons 1
See related  HGNC:8570|MIM:606512|Ensembl:ENSG00000124507|HPRD:05936|
Locus tag  -
Gene type  protein-coding
Map location  6p21.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.033 
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.04433 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004672protein kinase activityNAS-
GO:0008092cytoskeletal protein bindingIEA-
GO:0016301kinase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0045806negative regulation of endocytosisIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-
GO:0005737cytoplasmNAS-
GO:0030137COPI-coated vesicleIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ARHGAP17DKFZp564A1363 | FLJ37567 | FLJ43368 | MGC87805 | MST066 | MST110 | MSTP038 | MSTP066 | MSTP110 | NADRIN | RICH1 | WBP15Rho GTPase activating protein 17Reconstituted ComplexBioGRID11431473 
DNM1DNMdynamin 1-HPRD,BioGRID11082044 
-HPRD9950691 |11082044 
HTTHD | IT15huntingtin-HPRD,BioGRID12354780 
huntingtin interacts with PACSIN1.BIND12354780 
MYST2HBO1 | HBOA | KAT7MYST histone acetyltransferase 2Two-hybridBioGRID16169070 
PACSIN1KIAA1379 | SDPIprotein kinase C and casein kinase substrate in neurons 1-HPRD,BioGRID11082044 
PACSIN2SDPIIprotein kinase C and casein kinase substrate in neurons 2Reconstituted Complex
Two-hybrid
BioGRID11082044 |16189514 
PACSIN3SDPIIIprotein kinase C and casein kinase substrate in neurons 3-HPRD,BioGRID11082044 
SOS1GF1 | GGF1 | GINGF | HGF | NS4son of sevenless homolog 1 (Drosophila)-HPRD11352907 
SYNJ1INPP5Gsynaptojanin 1Reconstituted ComplexBioGRID11082044 
WASLDKFZp779G0847 | MGC48327 | N-WASP | NWASPWiskott-Aldrich syndrome-like-HPRD9950691|11179684 
Reconstituted ComplexBioGRID11082044 
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
NUYTTEN_EZH2_TARGETS_DN 1024594All SZGR genes in this pathway
CERVERA_SDHB_TARGETS_1_UP 11866All SZGR genes in this pathway
RAMALHO_STEMNESS_DN 7455All SZGR genes in this pathway
LEIN_NEURON_MARKERS 6945All SZGR genes in this pathway
MASSARWEH_TAMOXIFEN_RESISTANCE_UP 578341All SZGR genes in this pathway
MELLMAN_TUT1_TARGETS_DN 4729All SZGR genes in this pathway
MEISSNER_NPC_HCP_WITH_H3K4ME2 491319All SZGR genes in this pathway
MIKKELSEN_MCV6_HCP_WITH_H3K27ME3 435318All SZGR genes in this pathway
WONG_ADULT_TISSUE_STEM_MODULE 721492All SZGR genes in this pathway
MIKKELSEN_MEF_HCP_WITH_H3K27ME3 590403All SZGR genes in this pathway
SENGUPTA_EBNA1_ANTICORRELATED 17385All SZGR genes in this pathway
BRUINS_UVC_RESPONSE_VIA_TP53_GROUP_B 549316All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-103/107239724041A,m8hsa-miR-103brainAGCAGCAUUGUACAGGGCUAUGA
hsa-miR-107brainAGCAGCAUUGUACAGGGCUAUCA
miR-13322062212m8hsa-miR-133aUUGGUCCCCUUCAACCAGCUGU
hsa-miR-133bUUGGUCCCCUUCAACCAGCUA
miR-1820342040m8hsa-miR-18aUAAGGUGCAUCUAGUGCAGAUA
hsa-miR-18bUAAGGUGCAUCUAGUGCAGUUA
miR-3751361421Ahsa-miR-375UUUGUUCGUUCGGCUCGCGUGA
miR-92732801A,m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.