SZGR2

Summary ?

GeneID	3192
Symbol	HNRNPU
Synonyms	HNRNPU-AS1\|HNRPU\|SAF-A\|SAFA\|U21.1\|hnRNP U
Description	heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)
Reference	MIM:602869\|HGNC:HGNC:5048\|Ensembl:ENSG00000153187\|Ensembl:ENSG00000188206\|HPRD:04185\|Vega:OTTHUMG00000040396
Gene type	protein-coding
Map location	1q44
Sherlock p-value	0.057
Fetal beta	1.485
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg24517768	1	245028012	HNRNPU	9.5E-11	-0.01	4.49E-7	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs10035168	chr5	5974295	HNRNPU	3192		0.16		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MAB21L2	0.95	0.07
IRX2	0.84	-0.11
IRX1	0.67	-0.06
WFIKKN2	0.58	0.08
NRP1	0.54	0.04
ROBO3	0.54	0.13
PRDM6	0.49	0.06
TMC5	0.42	0.08
ROR2	0.38	0.18
MXRA5	0.36	0.15

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
WDR53	-0.11	-0.21
AP1S2	-0.10	-0.20
RALYL	-0.10	-0.21
ZNF860	-0.10	-0.32
RPL36AL	-0.09	-0.21
ZNF230	-0.09	-0.29
IER5L	-0.09	-0.10
GIN1	-0.09	-0.20
DNAJB6	-0.09	-0.29
PDCL3	-0.09	-0.26

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0003676	nucleic acid binding	IEA		-
GO:0003677	DNA binding	TAS		1628625
GO:0003723	RNA binding	TAS		1628625
GO:0005515	protein binding	IPI		17220478
GO:0005524	ATP binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000398	nuclear mRNA splicing, via spliceosome	EXP		12226669
GO:0008380	RNA splicing	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0005681	spliceosome	IEA		-
GO:0009986	cell surface	IEA		-
GO:0030529	ribonucleoprotein complex	IEA		-
GO:0030530	heterogeneous nuclear ribonucleoprotein complex	TAS		7509195

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACTB	PS1TP5BP1	actin, beta	ACTB (beta-actin) interacts with HNRPU (hnRNP U).	BIND	15711563
CDK7	CAK1 \| CDKN7 \| MO15 \| STK1 \| p39MO15	cyclin-dependent kinase 7	Affinity Capture-Western	BioGRID	10490622
CR2	C3DR \| CD21 \| SLEB9	complement component (3d/Epstein Barr virus) receptor 2	p120RNP interacts with CR2.	BIND	7753047
ELL	C19orf17 \| DKFZp434I1916 \| ELL1 \| Men	elongation factor RNA polymerase II	-	HPRD	10490622
EP300	KAT3B \| p300	E1A binding protein p300	-	HPRD,BioGRID	11909954
GRIN1	NMDA1 \| NMDAR1 \| NR1	glutamate receptor, ionotropic, N-methyl D-aspartate 1	-	HPRD	10862698
GTF2F1	BTF4 \| RAP74 \| TF2F1 \| TFIIF	general transcription factor IIF, polypeptide 1, 74kDa	Affinity Capture-Western	BioGRID	10490622
GTF2H1	BTF2 \| TFB1 \| TFIIH	general transcription factor IIH, polypeptide 1, 62kDa	-	HPRD	10490622
NDN	HsT16328 \| PWCR	necdin homolog (mouse)	-	HPRD,BioGRID	11813259
NR3C1	GCCR \| GCR \| GR \| GRL	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	-	HPRD,BioGRID	9353307
POLR2A	MGC75453 \| POLR2 \| POLRA \| RPB1 \| RPBh1 \| RPO2 \| RPOL2 \| RpIILS \| hRPB220 \| hsRPB1	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	Affinity Capture-Western	BioGRID	10490622
POU3F4	BRAIN-4 \| BRN4 \| DFN3 \| DFNX2 \| OTF9	POU class 3 homeobox 4	-	HPRD,BioGRID	9105675
PRMT1	ANM1 \| HCP1 \| HRMT1L2 \| IR1B4	protein arginine methyltransferase 1	-	HPRD,BioGRID	11850402
SFN	YWHAS	stratifin	Affinity Capture-MS	BioGRID	15778465
SFRS12	DKFZp564B176 \| MGC133045 \| SRrp508 \| SRrp86	splicing factor, arginine/serine-rich 12	-	HPRD	14559993

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG SPLICEOSOME	128	72	All SZGR 2.0 genes in this pathway
REACTOME PROCESSING OF CAPPED INTRON CONTAINING PRE MRNA	140	77	All SZGR 2.0 genes in this pathway
REACTOME MRNA PROCESSING	161	86	All SZGR 2.0 genes in this pathway
REACTOME MRNA SPLICING	111	58	All SZGR 2.0 genes in this pathway
LIU SOX4 TARGETS DN	309	191	All SZGR 2.0 genes in this pathway
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN	663	425	All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY UP	430	232	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 UP	380	236	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 UP	418	263	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP	501	327	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP	1278	748	All SZGR 2.0 genes in this pathway
BIDUS METASTASIS UP	214	134	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES SKIN UP	177	113	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
OUELLET OVARIAN CANCER INVASIVE VS LMP UP	117	85	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 TTD UP	64	39	All SZGR 2.0 genes in this pathway
DACOSTA LOW DOSE UV RESPONSE VIA ERCC3 XPCS UP	18	10	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 UP	309	199	All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER UP	358	245	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP	479	299	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX	795	478	All SZGR 2.0 genes in this pathway
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY UP	236	139	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN	514	330	All SZGR 2.0 genes in this pathway
STARK HYPPOCAMPUS 22Q11 DELETION UP	53	40	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 1 DN	169	102	All SZGR 2.0 genes in this pathway
DORSAM HOXA9 TARGETS UP	35	25	All SZGR 2.0 genes in this pathway
MANALO HYPOXIA DN	289	166	All SZGR 2.0 genes in this pathway
BROCKE APOPTOSIS REVERSED BY IL6	144	98	All SZGR 2.0 genes in this pathway
FAELT B CLL WITH VH REARRANGEMENTS DN	48	26	All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C2	54	39	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 14HR DN	298	200	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN	504	323	All SZGR 2.0 genes in this pathway
GENTILE UV RESPONSE CLUSTER D6	37	25	All SZGR 2.0 genes in this pathway
GENTILE UV HIGH DOSE DN	312	203	All SZGR 2.0 genes in this pathway
ZHOU TNF SIGNALING 30MIN	54	36	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 UP	428	266	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR	681	420	All SZGR 2.0 genes in this pathway
RAMASWAMY METASTASIS UP	66	43	All SZGR 2.0 genes in this pathway
JIANG HYPOXIA NORMAL	311	205	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED	1022	619	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL UP	648	398	All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER POOR SURVIVAL DN	22	15	All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING	510	309	All SZGR 2.0 genes in this pathway
ZHANG BREAST CANCER PROGENITORS UP	425	253	All SZGR 2.0 genes in this pathway
WANG TUMOR INVASIVENESS UP	374	247	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR DN	185	116	All SZGR 2.0 genes in this pathway
SAKAI CHRONIC HEPATITIS VS LIVER CANCER UP	83	63	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SUBCLASS S2	115	74	All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE DN	841	431	All SZGR 2.0 genes in this pathway
STAMBOLSKY TARGETS OF MUTATED TP53 UP	49	35	All SZGR 2.0 genes in this pathway
LU EZH2 TARGETS DN	414	237	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
JUBAN TARGETS OF SPI1 AND FLI1 DN	92	60	All SZGR 2.0 genes in this pathway
HOLLEMAN VINCRISTINE RESISTANCE B ALL DN	15	10	All SZGR 2.0 genes in this pathway
HOLLEMAN VINCRISTINE RESISTANCE ALL DN	19	11	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-1/206	86	93	1A,m8	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-101	855	861	1A	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-122	475	482	1A,m8	hsa-miR-122a	UGGAGUGUGACAAUGGUGUUUGU
miR-132/212	55	61	m8	hsa-miR-212^SZ	UAACAGUCUCCAGUCACGGCC
miR-132/212	55	61	m8	hsa-miR-132^brain	UAACAGUCUACAGCCAUGGUCG
miR-135	1421	1427	m8	hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
miR-135	1421	1427	m8	hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
miR-142-5p	1102	1108	1A	hsa-miR-142-5p	CAUAAAGUAGAAAGCACUAC
miR-144	854	861	1A,m8	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-150	1307	1313	1A	hsa-miR-150	UCUCCCAACCCUUGUACCAGUG
miR-186	62	68	1A	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-186	62	68	1A	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-19	1525	1532	1A,m8	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	1525	1532	1A,m8	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-200bc/429	234	240	m8	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-21	901	907	1A	hsa-miR-21^brain	UAGCUUAUCAGACUGAUGUUGA
miR-21	901	907	1A	hsa-miR-590	GAGCUUAUUCAUAAAAGUGCAG
miR-214	979	986	1A,m8	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG
miR-224	269	275	m8	hsa-miR-224	CAAGUCACUAGUGGUUCCGUUUA
miR-23	266	272	m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	266	272	m8	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-25/32/92/363/367	1040	1046	1A	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-30-3p	741	747	1A	hsa-miR-30a-3p	CUUUCAGUCGGAUGUUUGCAGC
miR-30-3p	741	747	1A	hsa-miR-30e-3p	CUUUCAGUCGGAUGUUUACAGC
miR-323	266	272	1A	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-330	309	315	m8	hsa-miR-330^brain	GCAAAGCACACGGCCUGCAGAGA
miR-409-3p	85	91	m8	hsa-miR-409-3p	CGAAUGUUGCUCGGUGAACCCCU
miR-433-3p	439	445	1A	hsa-miR-433^brain	AUCAUGAUGGGCUCCUCGGUGU
miR-495	1033	1039	m8	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-496	655	661	1A	hsa-miR-496	AUUACAUGGCCAAUCUC
miR-539	28	34	m8	hsa-miR-539	GGAGAAAUUAUCCUUGGUGUGU
miR-539	28	34	m8	hsa-miR-539	GGAGAAAUUAUCCUUGGUGUGU
miR-542-3p	383	389	1A	hsa-miR-542-3p	UGUGACAGAUUGAUAACUGAAA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: HNRNPU