SZGR2

Summary ?

GeneID	3717
Symbol	JAK2
Synonyms	JTK10\|THCYT3
Description	Janus kinase 2
Reference	MIM:147796\|HGNC:HGNC:6192\|Ensembl:ENSG00000096968\|HPRD:00993\|Vega:OTTHUMG00000019490
Gene type	protein-coding
Map location	9p24
Pascal p-value	0.16
Fetal beta	0.202

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 4.0087

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
KIF3C	0.90	0.94
CEP68	0.89	0.92
INPP4A	0.89	0.92
CECR6	0.88	0.91
ATCAY	0.88	0.92
CAPN5	0.88	0.92
KLHL18	0.88	0.93
KIAA0317	0.88	0.93
DCLK1	0.88	0.91
MAPT	0.88	0.94

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
FXYD1	-0.70	-0.79
SERPINB6	-0.69	-0.75
AF347015.31	-0.68	-0.79
S100B	-0.68	-0.77
AC021016.1	-0.68	-0.79
HEPN1	-0.68	-0.71
MT-CO2	-0.68	-0.80
AF347015.33	-0.67	-0.76
COPZ2	-0.67	-0.74
TSC22D4	-0.67	-0.72

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005102	receptor binding	IPI	Neurotransmitter (GO term level: 4)	11201744
GO:0000166	nucleotide binding	IEA		-
GO:0005515	protein binding	IEA		-
GO:0005524	ATP binding	IEA		-
GO:0004718	Janus kinase activity	IEA		-
GO:0004713	protein tyrosine kinase activity	IEA		-
GO:0004715	non-membrane spanning protein tyrosine kinase activity	IEA		-
GO:0016740	transferase activity	IEA		-
GO:0042169	SH2 domain binding	IPI		9727029
GO:0016301	kinase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0030099	myeloid cell differentiation	IEA		-
GO:0007262	STAT protein nuclear translocation	IEA		-
GO:0007260	tyrosine phosphorylation of STAT protein	IEA		-
GO:0007167	enzyme linked receptor protein signaling pathway	IEA		-
GO:0008285	negative regulation of cell proliferation	IEA		-
GO:0007498	mesoderm development	TAS		9590174
GO:0006928	cell motion	TAS		9670957
GO:0006915	apoptosis	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0012505	endomembrane system	IEA		-
GO:0005856	cytoskeleton	IEA		-
GO:0016020	membrane	IEA		-
GO:0045121	membrane raft	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AGTR1	AG2S \| AGTR1A \| AGTR1B \| AT1 \| AT1B \| AT1R \| AT2R1 \| AT2R1A \| AT2R1B \| HAT1R	angiotensin II receptor, type 1	-	HPRD	7746328
BCR	ALL \| BCR-ABL1 \| BCR1 \| CML \| D22S11 \| D22S662 \| FLJ16453 \| PHL	breakpoint cluster region	-	HPRD,BioGRID	12023981 \|12370803
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	-	HPRD,BioGRID	11163768
CCR2	CC-CKR-2 \| CCR2A \| CCR2B \| CD192 \| CKR2 \| CKR2A \| CKR2B \| CMKBR2 \| MCP-1-R	chemokine (C-C motif) receptor 2	-	HPRD,BioGRID	9670957
CCR5	CC-CKR-5 \| CCCKR5 \| CD195 \| CKR-5 \| CKR5 \| CMKBR5	chemokine (C-C motif) receptor 5	-	HPRD	11591716
CCR5	CC-CKR-5 \| CCCKR5 \| CD195 \| CKR-5 \| CKR5 \| CMKBR5	chemokine (C-C motif) receptor 5	Affinity Capture-Western	BioGRID	11278738
CSF2RB	CD131 \| CDw131 \| IL3RB \| IL5RB	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	Affinity Capture-Western in vivo Reconstituted Complex	BioGRID	7527392 \|7775438 \|10772872
CSF3R	CD114 \| GCSFR	colony stimulating factor 3 receptor (granulocyte)	-	HPRD	7775438
CTLA4	CD152 \| CELIAC3 \| CTLA-4 \| GSE \| IDDM12	cytotoxic T-lymphocyte-associated protein 4	CTLA-4 interacts with Jak2.	BIND	10842319
CTLA4	CD152 \| CELIAC3 \| CTLA-4 \| GSE \| IDDM12	cytotoxic T-lymphocyte-associated protein 4	-	HPRD,BioGRID	10842319
CXCR4	CD184 \| D2S201E \| FB22 \| HM89 \| HSY3RR \| LAP3 \| LCR1 \| LESTR \| NPY3R \| NPYR \| NPYRL \| NPYY3R \| WHIM	chemokine (C-X-C motif) receptor 4	-	HPRD,BioGRID	10506573
DNAJA3	FLJ45758 \| TID1 \| hTid-1	DnaJ (Hsp40) homolog, subfamily A, member 3	-	HPRD,BioGRID	11679576
DNAJA3	FLJ45758 \| TID1 \| hTid-1	DnaJ (Hsp40) homolog, subfamily A, member 3	JAK2 interacts with Tid-1S.	BIND	11679576
EGFR	ERBB \| ERBB1 \| HER1 \| PIG61 \| mENA	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)	Affinity Capture-Western	BioGRID	10358079
ELP2	FLJ10879 \| SHINC-2 \| STATIP1 \| StIP	elongation protein 2 homolog (S. cerevisiae)	-	HPRD,BioGRID	10954736
EPOR	MGC138358	erythropoietin receptor	-	HPRD,BioGRID	8343951 \|11779507
ERBB2	CD340 \| HER-2 \| HER-2/neu \| HER2 \| NEU \| NGL \| TKR1	v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)	-	HPRD,BioGRID	11940572
FYN	MGC45350 \| SLK \| SYN	FYN oncogene related to SRC, FGR, YES	-	HPRD,BioGRID	10551884
GHR	GHBP	growth hormone receptor	-	HPRD,BioGRID	7540178 \|8063815 \|10502458
GRB10	GRB-IR \| Grb-10 \| IRBP \| KIAA0207 \| MEG1 \| RSS	growth factor receptor-bound protein 10	-	HPRD,BioGRID	9632636
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	-	HPRD,BioGRID	7500025
HSPA8	HSC54 \| HSC70 \| HSC71 \| HSP71 \| HSP73 \| HSPA10 \| LAP1 \| MGC131511 \| MGC29929 \| NIP71	heat shock 70kDa protein 8	-	HPRD,BioGRID	11679576
HTR2A	5-HT2A \| HTR2	5-hydroxytryptamine (serotonin) receptor 2A	-	HPRD,BioGRID	9169451
IFNGR1	CD119 \| FLJ45734 \| IFNGR	interferon gamma receptor 1	Affinity Capture-Western	BioGRID	7673114
IFNGR2	AF-1 \| IFGR2 \| IFNGT1	interferon gamma receptor 2 (interferon gamma transducer 1)	-	HPRD	7514165
IFNGR2	AF-1 \| IFGR2 \| IFNGT1	interferon gamma receptor 2 (interferon gamma transducer 1)	Reconstituted Complex	BioGRID	7673114
IL12RB2	-	interleukin 12 receptor, beta 2	JAK2 interacts with IL12RB2.	BIND	9038232
IL12RB2	-	interleukin 12 receptor, beta 2	-	HPRD,BioGRID	10198225
IL23R	-	interleukin 23 receptor	-	HPRD	12023369
IL5RA	CD125 \| CDw125 \| HSIL5R3 \| IL5R \| MGC26560	interleukin 5 receptor, alpha	-	HPRD,BioGRID	9516124
IL6ST	CD130 \| CDw130 \| GP130 \| GP130-RAPS \| IL6R-beta	interleukin 6 signal transducer (gp130, oncostatin M receptor)	Affinity Capture-Western	BioGRID	9388212
IRS1	HIRS-1	insulin receptor substrate 1	Affinity Capture-Western Biochemical Activity	BioGRID	9492017 \|11208867
KIT	C-Kit \| CD117 \| PBT \| SCFR	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	-	HPRD,BioGRID	7527392 \|8611693 \|9355737
LEPR	CD295 \| OBR	leptin receptor	-	HPRD	8608603
LYN	FLJ26625 \| JTK8	v-yes-1 Yamaguchi sarcoma viral related oncogene homolog	-	HPRD,BioGRID	9573010
MDK	FLJ27379 \| MK \| NEGF2	midkine (neurite growth-promoting factor 2)	-	HPRD	9452495
OSMR	MGC150626 \| MGC150627 \| MGC75127 \| OSMRB	oncostatin M receptor	-	HPRD	10586060
PIK3R1	GRB1 \| p85 \| p85-ALPHA	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	-	HPRD,BioGRID	8702385
PPIA	CYPA \| CYPH \| MGC117158 \| MGC12404 \| MGC23397	peptidylprolyl isomerase A (cyclophilin A)	-	HPRD,BioGRID	12668872
PPP2R1B	MGC26454 \| PR65B	protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform	-	HPRD,BioGRID	11440634
PPP2R4	MGC2184 \| PP2A \| PR53 \| PTPA	protein phosphatase 2A activator, regulatory subunit 4	Affinity Capture-Western	BioGRID	8702385
PPP2R5A	B56A \| MGC131915 \| PR61A	protein phosphatase 2, regulatory subunit B', alpha isoform	-	HPRD	8702385
PRLR	hPRLrI	prolactin receptor	-	HPRD,BioGRID	10772872
PRMT5	HRMT1L5 \| IBP72 \| JBP1 \| SKB1 \| SKB1Hs	protein arginine methyltransferase 5	-	HPRD,BioGRID	10531356
PTK2	FADK \| FAK \| FAK1 \| pp125FAK	PTK2 protein tyrosine kinase 2	-	HPRD,BioGRID	9553131 \|10925297
PTK2B	CADTK \| CAKB \| FADK2 \| FAK2 \| FRNK \| PKB \| PTK \| PYK2 \| RAFTK	PTK2B protein tyrosine kinase 2 beta	-	HPRD,BioGRID	11818507
PTPN1	PTP1B	protein tyrosine phosphatase, non-receptor type 1	-	HPRD,BioGRID	11694501
PTPN11	BPTP3 \| CFC \| MGC14433 \| NS1 \| PTP-1D \| PTP2C \| SH-PTP2 \| SH-PTP3 \| SHP2	protein tyrosine phosphatase, non-receptor type 11	Biochemical Activity in vivo Reconstituted Complex	BioGRID	8639815 \|8912646 \|8995399
PTPN11	BPTP3 \| CFC \| MGC14433 \| NS1 \| PTP-1D \| PTP2C \| SH-PTP2 \| SH-PTP3 \| SHP2	protein tyrosine phosphatase, non-receptor type 11	-	HPRD	7559603 \|8912646 \|8995399
PTPN12	PTP-PEST \| PTPG1	protein tyrosine phosphatase, non-receptor type 12	-	HPRD,BioGRID	11731619
PTPN6	HCP \| HCPH \| HPTP1C \| PTP-1C \| SH-PTP1 \| SHP-1 \| SHP-1L \| SHP1	protein tyrosine phosphatase, non-receptor type 6	-	HPRD,BioGRID	8943354
PTPRC	B220 \| CD45 \| CD45R \| GP180 \| LCA \| LY5 \| T200	protein tyrosine phosphatase, receptor type, C	-	HPRD	11201744
RAF1	CRAF \| NS5 \| Raf-1 \| c-Raf	v-raf-1 murine leukemia viral oncogene homolog 1	-	HPRD,BioGRID	8876196
SH2B1	DKFZp547G1110 \| FLJ30542 \| KIAA1299 \| SH2-B \| SH2B	SH2B adaptor protein 1	-	HPRD,BioGRID	9343427
SH2B1	DKFZp547G1110 \| FLJ30542 \| KIAA1299 \| SH2-B \| SH2B	SH2B adaptor protein 1	-	HPRD	10757801
SH2B2	APS	SH2B adaptor protein 2	Biochemical Activity	BioGRID	10374881
SH2B2	APS	SH2B adaptor protein 2	-	HPRD	10872802
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	-	HPRD,BioGRID	7535773 \|9126968
SIRPA	BIT \| CD172A \| MFR \| MYD-1 \| P84 \| PTPNS1 \| SHPS-1 \| SHPS1 \| SIRP \| SIRP-ALPHA-1 \| SIRPalpha \| SIRPalpha2	signal-regulatory protein alpha	-	HPRD,BioGRID	10842184
SOCS1	CIS1 \| CISH1 \| JAB \| SOCS-1 \| SSI-1 \| SSI1 \| TIP3	suppressor of cytokine signaling 1	-	HPRD	9202126 \|10064597 \|11971965
SOCS1	CIS1 \| CISH1 \| JAB \| SOCS-1 \| SSI-1 \| SSI1 \| TIP3	suppressor of cytokine signaling 1	Affinity Capture-Western in vitro in vivo Reconstituted Complex Two-hybrid	BioGRID	9202126 \|10064597 \|10455112 \|11713228 \|11971965
SOCS3	ATOD4 \| CIS3 \| Cish3 \| MGC71791 \| SOCS-3 \| SSI-3 \| SSI3	suppressor of cytokine signaling 3	-	HPRD,BioGRID	9344848 \|10421843
STAM	DKFZp686J2352 \| STAM1	signal transducing adaptor molecule (SH3 domain and ITAM motif) 1	-	HPRD,BioGRID	9133424
STAM2	DKFZp564C047 \| Hbp \| STAM2A \| STAM2B	signal transducing adaptor molecule (SH3 domain and ITAM motif) 2	-	HPRD,BioGRID	10899310
STAT3	APRF \| FLJ20882 \| HIES \| MGC16063	signal transducer and activator of transcription 3 (acute-phase response factor)	-	HPRD	10925297
STAT5A	MGF \| STAT5	signal transducer and activator of transcription 5A	-	HPRD,BioGRID	9575217
STAT5B	STAT5	signal transducer and activator of transcription 5B	Affinity Capture-Western Two-hybrid	BioGRID	9047382 \|9575217
TEC	MGC126760 \| MGC126762 \| PSCTK4	tec protein tyrosine kinase	-	HPRD,BioGRID	9473212
TNFRSF1A	CD120a \| FPF \| MGC19588 \| TBP1 \| TNF-R \| TNF-R-I \| TNF-R55 \| TNFAR \| TNFR1 \| TNFR55 \| TNFR60 \| p55 \| p55-R \| p60	tumor necrosis factor receptor superfamily, member 1A	-	HPRD,BioGRID	9510175
TSHR	CHNG1 \| LGR3 \| MGC75129 \| hTSHR-I	thyroid stimulating hormone receptor	-	HPRD,BioGRID	10809230
TUB	rd5	tubby homolog (mouse)	-	HPRD,BioGRID	10455176
UBASH3B	KIAA1959 \| MGC15437 \| STS-1 \| STS1 \| p70	ubiquitin associated and SH3 domain containing, B	-	HPRD	12370296
VAV1	VAV	vav 1 guanine nucleotide exchange factor	-	HPRD,BioGRID	7530656 \|9162069
VCP	IBMPFD \| MGC131997 \| MGC148092 \| MGC8560 \| TERA \| p97	valosin-containing protein	-	HPRD,BioGRID	11087817
YES1	HsT441 \| P61-YES \| Yes \| c-yes	v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1	-	HPRD,BioGRID	8702385

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CHEMOKINE SIGNALING PATHWAY	190	128	All SZGR 2.0 genes in this pathway
KEGG JAK STAT SIGNALING PATHWAY	155	105	All SZGR 2.0 genes in this pathway
KEGG ADIPOCYTOKINE SIGNALING PATHWAY	67	57	All SZGR 2.0 genes in this pathway
KEGG LEISHMANIA INFECTION	72	56	All SZGR 2.0 genes in this pathway
BIOCARTA BIOPEPTIDES PATHWAY	45	35	All SZGR 2.0 genes in this pathway
BIOCARTA TID PATHWAY	19	15	All SZGR 2.0 genes in this pathway
BIOCARTA EPO PATHWAY	19	13	All SZGR 2.0 genes in this pathway
BIOCARTA EPONFKB PATHWAY	11	11	All SZGR 2.0 genes in this pathway
BIOCARTA GH PATHWAY	28	22	All SZGR 2.0 genes in this pathway
BIOCARTA IL3 PATHWAY	15	11	All SZGR 2.0 genes in this pathway
BIOCARTA IL6 PATHWAY	22	16	All SZGR 2.0 genes in this pathway
BIOCARTA IL12 PATHWAY	23	17	All SZGR 2.0 genes in this pathway
BIOCARTA IL22BP PATHWAY	16	12	All SZGR 2.0 genes in this pathway
BIOCARTA GLEEVEC PATHWAY	23	17	All SZGR 2.0 genes in this pathway
BIOCARTA NO2IL12 PATHWAY	17	14	All SZGR 2.0 genes in this pathway
BIOCARTA TPO PATHWAY	24	17	All SZGR 2.0 genes in this pathway
ST INTERFERON GAMMA PATHWAY	10	7	All SZGR 2.0 genes in this pathway
ST JAK STAT PATHWAY	9	8	All SZGR 2.0 genes in this pathway
ST STAT3 PATHWAY	11	10	All SZGR 2.0 genes in this pathway
ST INTERLEUKIN 4 PATHWAY	26	18	All SZGR 2.0 genes in this pathway
PID ENDOTHELIN PATHWAY	63	52	All SZGR 2.0 genes in this pathway
PID ERBB4 PATHWAY	38	32	All SZGR 2.0 genes in this pathway
PID GMCSF PATHWAY	37	31	All SZGR 2.0 genes in this pathway
PID IL4 2PATHWAY	65	43	All SZGR 2.0 genes in this pathway
PID IL27 PATHWAY	26	20	All SZGR 2.0 genes in this pathway
PID PTP1B PATHWAY	52	40	All SZGR 2.0 genes in this pathway
PID IL12 2PATHWAY	63	54	All SZGR 2.0 genes in this pathway
PID S1P S1P3 PATHWAY	29	24	All SZGR 2.0 genes in this pathway
PID SHP2 PATHWAY	58	46	All SZGR 2.0 genes in this pathway
PID CXCR4 PATHWAY	102	78	All SZGR 2.0 genes in this pathway
PID IL5 PATHWAY	14	11	All SZGR 2.0 genes in this pathway
PID IFNG PATHWAY	40	34	All SZGR 2.0 genes in this pathway
PID ERBB2 ERBB3 PATHWAY	44	35	All SZGR 2.0 genes in this pathway
PID IL3 PATHWAY	27	19	All SZGR 2.0 genes in this pathway
PID IL6 7 PATHWAY	47	40	All SZGR 2.0 genes in this pathway
PID PDGFRB PATHWAY	129	103	All SZGR 2.0 genes in this pathway
PID IL23 PATHWAY	37	30	All SZGR 2.0 genes in this pathway
PID KIT PATHWAY	52	40	All SZGR 2.0 genes in this pathway
PID EPO PATHWAY	34	29	All SZGR 2.0 genes in this pathway
PID HES HEY PATHWAY	48	39	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY SCF KIT	78	59	All SZGR 2.0 genes in this pathway
REACTOME GROWTH HORMONE RECEPTOR SIGNALING	24	19	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ERBB4	90	67	All SZGR 2.0 genes in this pathway
REACTOME PROLACTIN RECEPTOR SIGNALING	14	11	All SZGR 2.0 genes in this pathway
REACTOME NUCLEAR SIGNALING BY ERBB4	38	30	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ILS	107	86	All SZGR 2.0 genes in this pathway
REACTOME IL 3 5 AND GM CSF SIGNALING	43	34	All SZGR 2.0 genes in this pathway
REACTOME IL RECEPTOR SHC SIGNALING	27	21	All SZGR 2.0 genes in this pathway
REACTOME FACTORS INVOLVED IN MEGAKARYOCYTE DEVELOPMENT AND PLATELET PRODUCTION	132	101	All SZGR 2.0 genes in this pathway
REACTOME REGULATION OF IFNG SIGNALING	14	10	All SZGR 2.0 genes in this pathway
REACTOME INTERFERON GAMMA SIGNALING	63	48	All SZGR 2.0 genes in this pathway
REACTOME INTERFERON SIGNALING	159	116	All SZGR 2.0 genes in this pathway
REACTOME IL 2 SIGNALING	41	34	All SZGR 2.0 genes in this pathway
REACTOME IL 6 SIGNALING	11	9	All SZGR 2.0 genes in this pathway
REACTOME HEMOSTASIS	466	331	All SZGR 2.0 genes in this pathway
REACTOME IMMUNE SYSTEM	933	616	All SZGR 2.0 genes in this pathway
REACTOME CYTOKINE SIGNALING IN IMMUNE SYSTEM	270	204	All SZGR 2.0 genes in this pathway
PARENT MTOR SIGNALING UP	567	375	All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE UP	423	283	All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA DN	146	94	All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA BY DMOG DN	59	40	All SZGR 2.0 genes in this pathway
ELVIDGE HIF1A TARGETS UP	67	40	All SZGR 2.0 genes in this pathway
ELVIDGE HIF2A TARGETS UP	6	5	All SZGR 2.0 genes in this pathway
TSAI RESPONSE TO IONIZING RADIATION	149	101	All SZGR 2.0 genes in this pathway
PUJANA BREAST CANCER LIT INT NETWORK	101	73	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP	1037	673	All SZGR 2.0 genes in this pathway
BERTUCCI INVASIVE CARCINOMA DUCTAL VS LOBULAR UP	25	17	All SZGR 2.0 genes in this pathway
SHIN B CELL LYMPHOMA CLUSTER 3	28	23	All SZGR 2.0 genes in this pathway
MORI MATURE B LYMPHOCYTE UP	90	62	All SZGR 2.0 genes in this pathway
TENEDINI MEGAKARYOCYTE MARKERS	66	48	All SZGR 2.0 genes in this pathway
OKUMURA INFLAMMATORY RESPONSE LPS	183	115	All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS DN	366	238	All SZGR 2.0 genes in this pathway
FAELT B CLL WITH VH REARRANGEMENTS UP	48	34	All SZGR 2.0 genes in this pathway
HALMOS CEBPA TARGETS UP	52	34	All SZGR 2.0 genes in this pathway
JAIN NFKB SIGNALING	75	44	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
JACKSON DNMT1 TARGETS UP	77	57	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4	307	185	All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER T7	98	63	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED	1022	619	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
MARSON FOXP3 TARGETS STIMULATED UP	29	19	All SZGR 2.0 genes in this pathway
MARSON FOXP3 CORE DIRECT TARGETS	19	14	All SZGR 2.0 genes in this pathway
FOSTER TOLERANT MACROPHAGE DN	409	268	All SZGR 2.0 genes in this pathway
MARZEC IL2 SIGNALING DN	36	24	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN	366	257	All SZGR 2.0 genes in this pathway
HOFFMANN IMMATURE TO MATURE B LYMPHOCYTE UP	43	34	All SZGR 2.0 genes in this pathway
MIKKELSEN PLURIPOTENT STATE DN	8	7	All SZGR 2.0 genes in this pathway
JISON SICKLE CELL DISEASE UP	181	106	All SZGR 2.0 genes in this pathway
MARSON FOXP3 TARGETS DN	54	38	All SZGR 2.0 genes in this pathway
CAIRO LIVER DEVELOPMENT DN	222	141	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 6HR UP	229	149	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR UP	324	193	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE	1137	655	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP	745	475	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP	682	433	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 2HR DN	55	35	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-135	935	942	1A,m8	hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
miR-135	935	942	1A,m8	hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
miR-216	833	840	1A,m8	hsa-miR-216	UAAUCUCAGCUGGCAACUGUG
miR-375	636	642	1A	hsa-miR-375	UUUGUUCGUUCGGCUCGCGUGA
miR-381	656	662	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-433-3p	101	107	m8	hsa-miR-433^brain	AUCAUGAUGGGCUCCUCGGUGU
miR-496	325	331	1A	hsa-miR-496	AUUACAUGGCCAAUCUC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: JAK2