Gene Page: NEFM
Summary ?
GeneID | 4741 |
Symbol | NEFM |
Synonyms | NEF3|NF-M|NFM |
Description | neurofilament, medium polypeptide |
Reference | MIM:162250|HGNC:HGNC:7734|Ensembl:ENSG00000104722|HPRD:01205|Vega:OTTHUMG00000131990 |
Gene type | protein-coding |
Map location | 8p21 |
Pascal p-value | 0.577 |
Sherlock p-value | 0.791 |
Fetal beta | -1.791 |
Support | STRUCTURAL PLASTICITY G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanNRC CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_I | Genome scan meta-analysis | Psr: 0.031 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.00057 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.03086 | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 5 | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0523 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005198 | structural molecule activity | IEA | - | |
GO:0005200 | structural constituent of cytoskeleton | TAS | 3608989 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0031133 | regulation of axon diameter | IEA | axon (GO term level: 14) | - |
GO:0008088 | axon cargo transport | IEA | axon (GO term level: 8) | - |
GO:0000226 | microtubule cytoskeleton organization | IEA | - | |
GO:0045110 | intermediate filament bundle assembly | IEA | - | |
GO:0060052 | neurofilament cytoskeleton organization | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0031594 | neuromuscular junction | IEA | neuron, axon, Synap, Neurotransmitter (GO term level: 3) | - |
GO:0005883 | neurofilament | IEA | neuron, axon (GO term level: 11) | - |
GO:0005883 | neurofilament | TAS | neuron, axon (GO term level: 11) | 3608989 |
GO:0030424 | axon | TAS | neuron, axon, Neurotransmitter (GO term level: 6) | 14662745 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG AMYOTROPHIC LATERAL SCLEROSIS ALS | 53 | 43 | All SZGR 2.0 genes in this pathway |
DAVICIONI PAX FOXO1 SIGNATURE IN ARMS DN | 20 | 15 | All SZGR 2.0 genes in this pathway |
KIM RESPONSE TO TSA AND DECITABINE UP | 129 | 73 | All SZGR 2.0 genes in this pathway |
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS DN | 68 | 49 | All SZGR 2.0 genes in this pathway |
LEE NEURAL CREST STEM CELL UP | 146 | 99 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
KIM MYC AMPLIFICATION TARGETS UP | 201 | 127 | All SZGR 2.0 genes in this pathway |
HATADA METHYLATED IN LUNG CANCER UP | 390 | 236 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 12HR DN | 57 | 45 | All SZGR 2.0 genes in this pathway |
RICKMAN HEAD AND NECK CANCER C | 113 | 47 | All SZGR 2.0 genes in this pathway |
BENPORATH OCT4 TARGETS | 290 | 172 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
BENPORATH MYC TARGETS WITH EBOX | 230 | 156 | All SZGR 2.0 genes in this pathway |
FERNANDEZ BOUND BY MYC | 182 | 116 | All SZGR 2.0 genes in this pathway |
SMITH TERT TARGETS DN | 87 | 69 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
BASSO CD40 SIGNALING UP | 101 | 76 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 16HR UP | 225 | 139 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
MCCLUNG DELTA FOSB TARGETS 2WK | 48 | 36 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV NHEK UP | 244 | 151 | All SZGR 2.0 genes in this pathway |
MCCLUNG CREB1 TARGETS UP | 100 | 72 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 12HR UP | 111 | 68 | All SZGR 2.0 genes in this pathway |
DAZARD UV RESPONSE CLUSTER G2 | 30 | 18 | All SZGR 2.0 genes in this pathway |
IWANAGA CARCINOGENESIS BY KRAS PTEN UP | 181 | 112 | All SZGR 2.0 genes in this pathway |
ACEVEDO METHYLATED IN LIVER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
MALONEY RESPONSE TO 17AAG UP | 41 | 26 | All SZGR 2.0 genes in this pathway |
WANG TUMOR INVASIVENESS UP | 374 | 247 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3 | 142 | 103 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3 | 210 | 148 | All SZGR 2.0 genes in this pathway |
DAZARD UV RESPONSE CLUSTER G24 | 28 | 19 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP D | 280 | 158 | All SZGR 2.0 genes in this pathway |
YANG BCL3 TARGETS UP | 364 | 236 | All SZGR 2.0 genes in this pathway |
GHANDHI DIRECT IRRADIATION UP | 110 | 68 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 353 | 359 | 1A | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-124.1 | 320 | 326 | 1A | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-125/351 | 144 | 150 | m8 | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
miR-135 | 25 | 32 | 1A,m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-150 | 389 | 395 | 1A | hsa-miR-150 | UCUCCCAACCCUUGUACCAGUG |
miR-24 | 285 | 292 | 1A,m8 | hsa-miR-24SZ | UGGCUCAGUUCAGCAGGAACAG |
miR-25/32/92/363/367 | 117 | 124 | 1A,m8 | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.